An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-EVE-GH-004; SV 0; linear; genomic DNA; STS; SYN; 72 BP.
XX
AC   MON-00531-6;
XX
DT   18-NOV-2005
DT   03-NOV-2010
XX
DE   Quantitative PCR method for detection of cotton event MON531
DE   (Mazzara et al., 2008).
XX
KW   event_specific.
XX
OS   Gossypium hirsutum (upland cotton) - event MON531 (MON-00531-6)
XX
RN   [1]
RP   1-72
RA   Mazzara M., Bogni A., Foti N., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Cotton Line MON 531 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/43936
XX
RN   [2]
RP   1-72
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-GH-004.pdf
XX
DR   GMOMETHODS; QT-TAX-GH-015;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..72
FT                   /standard_name="PCR 72 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of cotton event MON531 and the cotton host genome"
FT   primer_bind     1..20
FT                   /standard_name="Primer forward: 531-F"
FT                   /note="AACCAATGCCACCCCACTGA"
FT                   /target="5'-host genome"
FT   primer_bind     complement(32..51)
FT                   /standard_name="RT-PCR probe: 531-P"
FT                   /note="FAM-TTGTCCCTCCACTTCTTCTC-TAMRA"
FT   primer_bind     complement(52..72)
FT                   /standard_name="Primer reverse: 531-R"
FT                   /note="TCCCATTCGAGTTTCTCACGT"
FT                   /target="insert"
XX
SQ   Sequence 72 BP; 24 A; 13 C; 18 G; 6 T; 11 other;
     aaccaatgcc accccactga nnnnnnnnnn ngagaagaag tggagggaca aacgtgagaa        60
     actcgaatgg ga                                                            72
//