Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-EVE-ZM-036; SV 0; linear; genomic DNA; STD; SYN; 85 BP.
XX
AC   MON-95275-7;
XX
DT   14-FEB-2024
DT   14-FEB-2024
XX
DE   Quantitative PCR method for detection of maize event MON 95275 (EURL
DE   GMFF, 2023).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event MON 95275 (MON-95275-7)
XX
RN   [1]
RP   1-85
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF),
RT   Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize MON 95275 Using Real-time PCR -
RT   Validation Report";
RL   Online Publication (2023).
RX   EURL_GMFF=EURL-VL-01-22-VR.pdf
RX   EURL_GMFF=EURL-VL-01-22-VM.pdf
XX
RN   [2]
RP   1-85
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2023).
RX   PCR=QT-EVE-ZM-036.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..85
FT                   /standard_name="PCR 85 bp amplicon"
FT                   /note="Event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of maize event MON 95275 and the maize host genome"                
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: MON 95275 primer 1"
FT                   /note="GCGCATGAAGTTTCAGGTCTGT"
FT                   /target="5'-host genome"
FT   primer_bind     25..46
FT                   /standard_name="RT-PCR probe: MON 95275 probe"
FT                   /note="FAM-CAGCCGGCCCGATCAAACACTG-TAMRA"
FT   primer_bind     complement(60..85)
FT                   /standard_name="Primer reverse: MON 95275 primer 2"
FT                   /note="GTCGCTACCTTAGGACCGTTATAGTT"
FT                   /target="insert"
XX
SQ   Sequence 85 BP; 22 A; 22 C; 22 G; 19 T; 0 other;
     gcgcatgaag tttcaggtct gtnncagccg gcccgatcaa acactgnnnn nnnnnnnnna        60
     actataacgg tcctaaggta gcgac                                              85
//