Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:ACS-BN004-7'
ID   QT-EVE-ZM-031; SV 0; linear; genomic DNA; STD; PLN; 74 BP.
XX
AC   DP-915635-4;
XX
DT   19-AUG-2022
DT   03-MAY-2023
XX
DE   Quantitative PCR method for detection of maize event DP915635 (EURL GMFF, 2023).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event DP915635 (DP-915635-4)
XX
RN   [1]
RP   1-74
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize DP915635 Using Real-time PCR - Validation Report";
RL   Online Publication (2023).
RX   EURL_GMFF=EURL-VL-05-20-VR.pdf
RX   EURL_GMFF=EURL-VL-05-20-VM.pdf
XX
RN   [2]
RP   1-74
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2023).
RX   PCR=QT-EVE-ZM-031.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-005;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..74
FT                   /standard_name="PCR 74 bp amplicon"
FT                   /note="Event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of maize event DP915635 and the maize host genome"
FT   primer_bind     1..27
FT                   /standard_name="Primer forward: DP-915635-3F"
FT                   /note="GCATCTAGGACCGACTAGCTAACTAAC"
FT                   /target="insert"
FT   primer_bind     35..49
FT                   /standard_name="RT-PCR probe: 2059 probe"
FT                   /note="FAM-CGCCATGAGGAGCAA-MGB"
FT   primer_bind     complement(51..74)
FT                   /standard_name="Primer reverse: DP-915635-3R"
FT                   /note="CTTTGCATCATGTCTTGAACAATG"
FT                   /target="3'-host genome"
XX
SQ   Sequence 74 BP; 24 A; 17 C; 19 G; 14 T; 0 other;
     gcatctagga ccgactagct aactaacnnn nnnncgccat gaggagcaan cattgttcaa        60
     gacatgatgc aaag                                                          74
//