Only one hit for query 'ac%3aACS-BN004-7'
ID QT-EVE-BN-008; SV 0; linear; genomic DNA; STS; SYN; 95 BP. XX AC ACS-BN007-1; XX DT 29-NOV-2011 DT 11-FEB-2008 XX DE Quantitative PCR method for detection of oilseed rape event Topas 19/2 (verified by the EU-RL GMFF in the context of Commission Decision 2007/307/EC) XX KW event_specific, EU-RL_GMFF_in-house_verified. XX OS Brassica napus (oilseed rape) - event Topas 19/2 (ACS-BN007-1) XX RN [1] RP 1-95 RA Mazzara M.,; RT "In-house Validation of an Event-specific Method for the Quantification of Oilseed Rape Topas 19/2 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2011). RX EURL_GMFF=CRLVL1204 VR.pdf RX EURL_GMFF=CRLVL1204 VP.pdf XX RN [2] RP 1-95 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2011). RX PCR=QT-EVE-BN-008.pdf XX DR GMOMETHODS; QT-TAX-BN-012; XX FH Key Location/Qualifiers FH FT STS 1..95 FT /standard_name="PCR 95 bp amplicon" FT /note="event-specific RT-PCR" FT /target="3'integration border region (IBR) between the insert of oilseed rape event Topas 19/2 and the oilseed rape host genome"; FT primer_bind 1..20 FT /standard_name="Primer forward: MDB685" FT /note="GTTGCGGTTCTGTCAGTTCC" FT /target="insert"; FT primer_bind 38..54 FT /standard_name="RT-PCR probe: TM029" FT /note="FAM-TCCCGCGTCATCGGCGG-TAMRA" FT primer_bind complement(76..95) FT /standard_name="Primer reverse: KVM180" FT /note="CGACCGGCGCTGATATATGA" FT /target="3'-host genome" XX SQ Sequence 95 BP; 16 A; 27 C; 29 G; 23 T; 0 other; gttgcggttc tgtcagttcc nnnnnnnnnn nnnnnnntcc cgcgtcatcg gcggnnnnnn 60 nnnnnnnnnn nnnnntcata tatcagcgcc ggtcg 95 //