An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-EVE-ZM-006; SV 0; linear; genomic DNA; STS; SYN; 70 BP.
XX
AC   SYN-BT011-1;
XX
DT   13-JUN-2006
DT   08-NOV-2010
XX
DE   Quantitative PCR method for detection of maize event Bt11
DE   (Mazzara et al., 2005).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event Bt11 (SYN-BT011-1)
XX
RN   [1]
RP   1-70
RA   Mazzara M., Puumalaainen J., Van Den Eede G.;
RT   "Validation of the GMO Specific Detection Method Developed by NVI/INRA for Bt11 in Sweet Corn Maize - Validation Report and Protocol";
RL   Online Publication (2005).
RX   BSHOP=LBNA21829
XX
RN   [2]
RP   1-70
RT   "Foodstuffs - Methods of analysis for the detection of genetically
RT   modified organisms and derived products - Quantitative nucleic acid based
RT   methods";
RL   ISO 21570:1-103 (2005).
RX   ISO=34615
XX
RN   [3]
RP   1-70
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-ZM-006.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-001;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..70
FT                   /standard_name="event-specific PCR amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of maize event Bt11 and the maize host genome"
FT   primer_bind     1..20
FT                   /standard_name="Primer forward: Bt113JFor"
FT                   /note="GCGGAACCCCTATTTGTTTA"
FT                   /target="insert"
FT   primer_bind     28..54
FT                   /standard_name="RT-PCR probe: Bt113JFT"
FT                   /note="FAM-AAATACATTCAAATATGTATCCGCTCA-TAMRA"
FT   primer_bind     complement(51..70)
FT                   /standard_name="Primer reverse: Bt113JRev"
FT                   /note="TCCAAGAATCCCTCCATGAG"
FT                   /target="3' junction"
XX
SQ   Sequence 70 BP; 18 A; 12 C; 13 G; 20 T; 7 other;
     gcggaacccc tatttgttta nnnnnnnaaa tacattcaaa tatgtatccg ctcatggagg        60
     gattcttgga                                                               70
//