An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-TAX-BN-002; SV 0; linear; genomic DNA; STS; PLN; 78 BP.
XX
AC   ;
XX
DT   22-NOV-2012
DT   03-DEC-2013
XX
DE   Quantitative PCR method for detection of oilseed rape cruciferin
DE   storage protein (Savini et al., 2013).
XX
KW   taxon_specific, validated_in_combination.
XX
OS   Brassica napus (oilseed rape)
XX
RN   [1]
RP   1-78
RA   Savini C., et al.;
RT   "Event-specific Method for the Quantification of Oilseed Rape MON88302 Using Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2013).
RX   EURL_GMFF=EURL-VL-09-11-VR-MON88302.pdf
RX   EURL_GMFF=EURL-VL-09-11-VM-MON88302.pdf
XX
RN   [2]
RP   1-78
RT   "See Cross-references below";
RL   Online Publication (2013).
XX
DR   GMOMETHODS; QT-EVE-BN-010;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..78
FT                   /standard_name="PCR 78 bp amplicon"
FT                   /note="taxon-specific RT-PCR"
FT                   /target="cruciferin storage protein (BnC1) gene"
FT   primer_bind     1..24
FT                   /standard_name="Primer forward: ccf R"
FT                   /note="GCTTCCGTGATATGCACCAGAAAG"
FT                   /target="BnC1"
FT   primer_bind     complement(27..54)
FT                   /standard_name="RT-PCR probe: ccf P"
FT                   /note="VIC-CGATGGTGTCCCCAGTCCTTATGTGCTC-TAMRA"
FT   primer_bind     complement(57..78)
FT                   /standard_name="Primer reverse: ccf F"
FT                   /note="ATTGGGCTACACCGGGATGTGT"
FT                   /target="BnC1"
XX
SQ   Sequence 78 BP; 22 A; 22 C; 20 G; 14 T; 0 other;
     gcttccgtga tatgcaccag aaagnngagc acataaggac tggggacacc atcgnnacac        60
     atcccggtgt agcccaat                                                      78
//