An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:ACS-BN003-6'
ID   QT-EVE-BN-003; SV 0; linear; genomic DNA; STS; SYN; 139 BP.
XX
AC   ACS-BN003-6;
XX
DT   05-MAR-2007
DT   05-NOV-2010
XX
DE   Quantitative PCR method for detection of oilseed rape event Rf3
DE   (Savini et al., 2007).
XX
KW   event_specific.
XX
OS   Brassica napus (oilseed rape) - event Rf3 (ACS-BN003-6)
XX
RN   [1]
RP   1-139
RA   Savini C., Bogni A., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Oilseed Rape Line Rf3 Using Real-time PCR - Validation Report and Protocol - Seeds Sampling and DNA Extraction";
RL   Online Publication (2007).
RX   DOI=10.2788/28179 
XX
RN   [2]
RP   1-139
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-BN-003.pdf
XX
DR   GMOMETHODS; QT-TAX-BN-012;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..139
FT                   /standard_name="PCR 139 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of oilseed rape event Rf3 and the oilseed rape host genome"
FT   primer_bind     1..24
FT                   /standard_name="Primer forward: DPA165"
FT                   /note="CATAAAGGAAGATGGAGACTTGAG"
FT                   /target="insert"
FT   primer_bind     complement(88..112)
FT                   /standard_name="RT-PCR probe: TM010"
FT                   /note="FAM-CGCACGCTTATCGACCATAAGCCCA-TAMRA"
FT   primer_bind     complement(115..139)
FT                   /standard_name="Primer reverse: KVM084"
FT                   /note="AGCATTTAGCATGTACCATCAGACA"
FT                   /target="3'-host genome"
XX
SQ   Sequence 139 BP; 20 A; 10 C; 24 G; 20 T; 65 other;
     cataaaggaa gatggagact tgagnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnntgg gcttatggtc gataagcgtg cgnntgtctg       120
     atggtacatg ctaaatgct                                                    139
//