An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QL-ELE-00-015; SV 1; linear; genomic DNA; STD; VRT; 78 BP.
XX
AC   ;
XX
DT   19-AUG-1988
DT   10-MAY-2017
XX
DE   Qualitative PCR method for detection of Figwort Mosaic Virus 35S promoter
XX
KW   element_specific.
XX
RN   [1]
RP   1-78
RT   "Detection of a DNA sequence of the FMV-promoter (pFMV) in foodstuffs with real-time PCR";
RL   BVL L 00.00-148:2014-02(2014).
RX   BVL=bvl-l-0000-148/202225005
XX
RN   [2]
RP   1-78
RT   "Horizontal methods for molecular biomarker analysis -- Methods of analysis for the detection of genetically modified organisms and derived products -- Part 5: Real-time PCR based screening method for the detection of the FMV promoter (P-FMV) DNA sequence";
RL   ISO/TS 21569-5:2016 (2016).
RX   ISO=69340
XX
RN   [3]
RP   1-78
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2014).
RX   PCR=QL-ELE-00-015.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..78
FT                   /standard_name="PCR 78 bp amplicon"
FT                   /note="element-specific RT-PCR"
FT                   /target="Figwort Mosaic Virus 35S promoter (P-FMV)"
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: pFMV-F"
FT                   /note="CAAAATAACGTGGAAAAGAGCT"
FT                   /target="P-FMV"
FT   primer_bind     26..47
FT                   /standard_name="RT-PCR probe: Probe pFMV"
FT                   /note="FAM-CTGACAGCCCACTCACTAATGC-BHQ1"
FT   primer_bind     complement(59..78)
FT                   /standard_name="Primer reverse: pFMV-R"
FT                   /note="TCTTTTGTGGTCGTCACTGC"
FT                   /target="P-FMV"
XX
SQ   Sequence 78 BP; 30 A; 20 C; 17 G; 11 T; 0 other;
     caaaataacg tggaaaagag ctnnnctgac agcccactca ctaatgcnnn nnnnnnnngc        60
     agtgacgacc acaaaaga                                                      78
//