Only one hit for query 'ac%3aDAS-81419-2'
ID QT-EVE-BN-003; SV 0; linear; genomic DNA; STS; SYN; 139 BP. XX AC ACS-BN003-6; XX DT 05-MAR-2007 DT 05-NOV-2010 XX DE Quantitative PCR method for detection of oilseed rape event Rf3 DE (Savini et al., 2007). XX KW event_specific. XX OS Brassica napus (oilseed rape) - event Rf3 (ACS-BN003-6) XX RN [1] RP 1-139 RA Savini C., Bogni A., Mazzara M., Van Den Eede G.; RT "Event-specific Method for the Quantification of Oilseed Rape Line Rf3 Using Real-time PCR - Validation Report and Protocol - Seeds Sampling and DNA Extraction"; RL Online Publication (2007). RX DOI=10.2788/28179 XX RN [2] RP 1-139 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-BN-003.pdf XX DR GMOMETHODS; QT-TAX-BN-012; XX FH Key Location/Qualifiers FH FT STS 1..139 FT /standard_name="PCR 139 bp amplicon" FT /note="event-specific RT-PCR" FT /target="3' integration border region (IBR) between the insert of oilseed rape event Rf3 and the oilseed rape host genome" FT primer_bind 1..24 FT /standard_name="Primer forward: DPA165" FT /note="CATAAAGGAAGATGGAGACTTGAG" FT /target="insert" FT primer_bind complement(88..112) FT /standard_name="RT-PCR probe: TM010" FT /note="FAM-CGCACGCTTATCGACCATAAGCCCA-TAMRA" FT primer_bind complement(115..139) FT /standard_name="Primer reverse: KVM084" FT /note="AGCATTTAGCATGTACCATCAGACA" FT /target="3'-host genome" XX SQ Sequence 139 BP; 20 A; 10 C; 24 G; 20 T; 65 other; cataaaggaa gatggagact tgagnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnntgg gcttatggtc gataagcgtg cgnntgtctg 120 atggtacatg ctaaatgct 139 //