An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-ELE-00-004; SV 0; linear; genomic DNA; STS; SYN; 82 BP.
XX
AC   ;
XX
DT   29-MAY-2009
DT   20-JUNE-2013
XX
DE   Quantitative PCR method for detection of Cauliflower Mosaic Virus 35S promoter
XX
KW   element_specific.
XX
RN   [1]
RP   1-82
RA   Pauli U., Liniger M., Schrott M., Schouwey B., Huebner P., Brodmann P.,
RA   Eugster A.;
RT   "Quantitative detection of genetically modified soybean and maize: method
RT   evaluation in a swiss ring trial";
RL   Mitt. Lebensm. Hyg. 92:145-158 (2001).
XX
RN   [2]
RP   1-82
RT   "Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods";
RL   ISO 21570:1-103 (2005).
RX   ISO=34615
XX
RN   [3]
RP   1-82
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2013).
RX   PCR=QT-ELE-00-004.pdf
XX
DR   GMOMETHODS; QT-TAX-GM-001;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..82
FT                   /standard_name="PCR 82 bp amplicon"
FT                   /note="element-specific RT-PCR"
FT                   /target="Cauliflower Mosaic Virus 35S promoter (CaMV P-35S)"
FT   primer_bind     1..18
FT                   /standard_name="Primer forward: 35S-F"
FT                   /note="GCCTCTGCCGACAGTGGT"
FT                   /target="CaMV P-35S"
FT   primer_bind     21..42
FT                   /standard_name="RT-PCR probe: 35S-TMP"
FT                   /note="FAM-CAAAGATGGACCCCCACCCACG-TAMRA"
FT   primer_bind     complement(61..82)
FT                   /standard_name="Primer reverse: 35S-R"
FT                   /note="AAGACGTGGTTGGAACGTCTTC"
FT                   /target="CaMV P-35S"
XX
SQ   Sequence 82 BP; 23 A; 27 C; 20 G; 12 T; 0 other;
     gcctctgccg acagtggtnn caaagatgga cccccaccca cgnnnnnnnn nnnnnnnnnn        60
     gaagacgttc caaccacgtc tt                                                 82
//