An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:SYN-IR162-4'
ID   QT-EVE-ZM-022; SV 0; linear; genomic DNA; STS; SYN; 92 BP.
XX
AC   SYN-IR162-4;
XX
DT   21-JAN-2009
DT   5-FEB-2015
XX
DE   Quantitative PCR method for detection of maize event MIR162 (Charles Delobel et al., 2011)
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event MIR162 (SYN-IR162-4)
XX
RN   [1]
RP   1-92
RA   Charles Delobel C., Mazzara M., Bevilacqua A., Van den Eede G.;
RT   "Event-specific Method for the Quantification of Maize MIR162 by Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2011).
RX   DOI=10.2788/44161
XX
RN   [2]
RP   1-92
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2011).
RX   PCR=QT-EVE-ZM-022.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-014;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..92
FT                   /standard_name="PCR 92 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of maize event MIR162 and the maize host genome";
FT   primer_bind     1..24
FT                   /standard_name="Primer forward: MIR162-f1"
FT                   /note="GCGCGGTGTCATCTATGTTACTAG"
FT                   /target="insert"
FT   primer_bind     34..67
FT                   /standard_name="RT-PCR probe: MIR162-p1"
FT                   /note="FAM-TCTAGACAATTCAGTACATTAAAAACGTCCGCCA-
FT                   TAMRA"
FT   primer_bind     complement(71..92)
FT                   /standard_name="Primer reverse: MIR162-r1"
FT                   /note="TGCCTTATCTGTTGCCTTCAGA"
FT                   /target="3'-host genome"
XX
SQ   Sequence 92 BP; 27 A; 22 C; 22 G; 21 T; 0 other;
     gcgcggtgtc atctatgtta ctagnnnnnn nnntctagac aattcagtac attaaaaacg        60
     tccgccannn tctgaaggca acagataagg ca                                      92
//