An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QL-EVE-DC-001; SV 0; linear; genomic DNA; STS; SYN; 375 BP.
XX
AC   FLO-40644-6;
XX
DT   12-MAR-2007
DT   01-DEC-2016
XX
DE   Qualitative PCR method for detection of carnation event 123-2-38 (verified by the CRL GMFF in the context of Commission Decision 2007/364/EC).
XX
KW   event_specific, EU-RL_GMFF_in-house_verified.
XX
OS   Dianthus caryophyllus (carnation)- event 123.2.38 (FLO-40644-6)
XX
CC   NOTE: This GMO was formerly referred to with the Unique identifier (UI)
CC   (FLO-40644-4) which OECD corrected (JAN 2015).
XX
RN   [1]
RP   1-375
RA   Savini C., Querci M., Moens W., Mazzara M., Cordeil S., Van den Eede G.;
RT   "Report on the Testing of a PCR-based Detection Method for Identification
RT   of FlorigeneTM Moonlite GM Carnation - Protocol CRLEM03/06VR. Version 2";
RL   Online Publication (2007).
RX   EURL_2001=CRL_Report_Flor_Moonlite_v2.pdf
XX
RN   [2]
RP   1-375
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2016)
RX   PCR=QL-EVE-DC-001.pdf
XX
DR   GMOMETHODS; QL-TAX-DC-001;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..375
FT                   /standard_name="PCR 375 bp amplicon"
FT                   /note="Event-specific PCR"
FT                   /target="5' integration border region (IBR) between the insert of carnation event 123.2.38 and the carnation host genome"
FT   primer_bind     1..20
FT                   /standard_name="Primer forward: LB123.2.38-R"
FT                   /note="CAATGCCTCGCCTTTTGTGG"
FT                   /target="5'-host genome"
FT   primer_bind     complement(356..375)
FT                   /standard_name="Primer reverse: LB inside.R"
FT                   /note="ACGTGAATGTAGACACGTCG"
FT                   /target="insert"
XX
SQ   Sequence 375 BP; 130 A; 52 C; 71 G; 122 T; 0 other;
     caatgcctcg ccttttgtgg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       180
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       240
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnncgacg       360
     tgtctacatt cacgt                                                        375
//