Only one hit for query 'id:QL-eve-os*'
ID QL-EVE-OS-001; SV 0; linear; genomic DNA; STS; SYN; 66 BP. XX AC BCS-OS003-7; XX DT 06-DEC-2011 DT 26-FEB-2008 XX DE Qualitative PCR method for detection of rice event LLRICE601 (verified by the EU-RL GMFF in the context of Commission Decision 2006/578/EC) XX KW event_specific, EU-RL_GMFF_in-house_verified. XX OS Oryza sativa (rice) - event LLRICE601 (BCS-OS003-7) XX RN [1] RP 1-66 RA Mazzara M., Cordeil S., Van den Eede G.; RT "Report on the Verification of an Event-specific Detection Method for RT Identification of Rice GM-Event LLRICE601 Using a Real-time PCR Assay"; RL Online Publication (2006). RX EURL_GMFF=Verification Report LLRice601 event.pdf XX RN [2] RP 1-66 RA Mazzara M., Cordeil S., Van den Eede G.; RT "Addendum to the Report on the Verification of an Event-specific RT Detection Method for Identification of Rice GM-Event LLRICE601 Using a RT Real-time PCR Assay"; RL Online Publication (2006). RX EURL_GMFF=Verification Report LLRice601 event addendum on Table 4.pdf XX RN [3] RP 1-66 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2011). RX PCR=QL-EVE-OS-001.pdf XX DR GMOMETHODS; QL-TAX-OS-002; XX FH Key Location/Qualifiers FH FT STS 1..66 FT /standard_name="PCR 66 bp amplicon" FT /note="event-specific RT-PCR" FT /target="3' integration border region (IBR) between the insert of rice event LLRICE601 and the rice host genome"; FT primer_bind 1..22 FT /standard_name="Primer forward: SHA040" FT /note="TCTAGGATCCGAAGCAGATCGT" FT /target="insert"; FT primer_bind 24..49 FT /standard_name="RT-PCR probe: TM098" FT /note="FAM-CCACCTCCCAACAATAAAAGCGCCTG-TAMRA" FT primer_bind complement(51..66) FT /standard_name="Primer reverse: SHA041" FT /note="GGAGGGCGCGGAGTGT" FT /target="3'-host genome" XX SQ Sequence 66 BP; 17 A; 27 C; 11 G; 11 T; 0 other; tctaggatcc gaagcagatc gtnccacctc ccaacaataa aagcgcctgn acactccgcg 60 ccctcc 66 //