An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)

Perform your search by keyword, select a GMO unique identifier or click a link in the section below.

ID   QT-EVE-GM-016; SV 0; linear; genomic DNA; STS; SYN; 87 BP.
AC   MON-87751-7;
DT   30-SEP-2014
DT   11-SEP-2019
DE   Quantitative PCR method for detection of soybean event MON87751 (EURL GMFF, 2016).
KW   event_specific.
OS   Glycine max (soybean) - event MON87751 (MON-87751-7)
RN   [1]
RP   1-87
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Soybean MON 87751 Using Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2016).
RX   EURL_GMFF=EURL-VL-03-14-VR-Corrected-Version-1.pdf
RX   EURL_GMFF=EURL-VL-03-14-VP-Corrected-Version-1.pdf
RN   [2]
RP   1-87
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2016).
RX   PCR=QT-EVE-GM-016.pdf
FH   Key             Location/Qualifiers
FT   STS             1..87
FT                   /standard_name="PCR 87 bp amplicon"
FT                   /note="Event-specific RT-PCR;
FT                   /target="5' integration border region (IBR) between the insert of soybean event MON87751 and the soybean host genome";
FT   primer_bind     1..30
FT                   /standard_name="Primer forward: MON 87751  primer 2"
FT                   /target="5'-host genome"
FT   primer_bind     complement(34..62)
FT                   /standard_name="RT-PCR probe: MON 87751 probe"
FT   primer_bind     complement(64..87)
FT                   /standard_name="Primer reverse: MON 87751 primer 1"
FT                   /note="GGCCTAACTTTTGGTGTGATGATG"
FT                   /target="insert"
SQ   Sequence 87 BP; 22 A; 21 C; 14 G; 30 T; 0 other;
     ctaaattgct ctttggagtt tattttgtag nnntttcccc tcactttgga gatctccagt        60
     cancatcatc acaccaaaag ttaggcc                                            87