Perform your search by keyword, select a GMO unique identifier or click a link in the section below.

ID   QL-EVE-DC-005; SV 0; linear; genomic DNA; STS; SYN; 458 BP.
AC   SHD-27531-4;
DT   16-MAY-2013
DT   01-DEC-2016
DE   Qualitative PCR method for detection of carnation event 27531 (verified by the EURL GMFF in the context of Commission Implementing Decision (EU) 2016/2050).
KW   event_specific, EU-RL_GMFF_in-house_verified.
OS   Dianthus caryophyllus (carnation) - event 27531 (SHD-27531-4)
RN   [1]
RP   1-458
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Report on the Single-laboratory Validation of a PCR-based Detection Method for Identification of SHD-27531-4 GM Carnation - 
RT   JRC Validated Methods, Reference Methods and Measurement Reports";
RL   Online Publication (2016).
RX   EURL_2001=EURL-EV-01-13-Final-Report.pdf
RN   [2]
RP   1-458
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2016).
RX   PCR=QL-EVE-DC-005.pdf
FH   Key             Location/Qualifiers
FT   STS             1..458
FT                   /standard_name="PCR 458 bp amplicon"
FT                   /note="Event-specific PCR";
FT                   /target="5' integration border region (IBR) between the insert of carnation event 27531 and the carnation host genome"
FT   primer_bind     1..21
FT                   /standard_name="Primer forward: 27531 LB Specific fw"
FT                   /note="CGAGTAAATTCAAGCATGCCC"
FT                   /target="5'-host genome"
FT   primer_bind     complement(434..458)
FT                   /standard_name="Primer reverse: carLB-reverse"
FT                   /note="CCATATTGACCATCATACTCATTGC"
FT                   /target="insert"
SQ   Sequence 458 BP; 160 A; 74 C; 93 G; 131 T; 0 other;
     cgagtaaatt caagcatgcc cnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       180
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       240
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       420
     nnnnnnnnnn nnngcaatga gtatgatggt caatatgg                               458