ID QL-CON-00-008; SV 0; linear; genomic DNA; STS; SYN; 88 BP. XX AC ; XX DT 04-AUG-2009 DT 05-OCT-2010 XX DE Qualitative PCR method for detection of the junction between the chloroplast transit peptide 2 and the CP4 epsps gene DE (Grohmann et al., 2009). XX KW construct_specific. XX RN [1] RP 1-88 RA Grohmann L., Brunen-Nieweler C., Nemeth A., Waiblinger H.U.; RT "Collaborative trial validation studies of real-time PCR-based GMO RT screening methods for detection of the bar gene and the ctp2-cp4epsps RT construct"; RL J. Agric. Food Chem. 57:8913-8920 (2009). RX PUBMED; 19807158. RX DOI=10.1021/jf901598r XX RN [2] RP 1-88 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QL-CON-00-008.pdf XX FH Key Location/Qualifiers FH FT STS 1..88 FT /standard_name="PCR 88 bp amplicon" FT /note="construct-specific RT-PCR" FT /target="Junction region between the chloroplast transit peptide 2 (CTP2) sequence from the Arabidopsis thaliana epsps gene and the CP4 epsps gene from Agrobacterium tumefasciens (CP4 EPSPS)" FT primer_bind 1..22 FT /standard_name="Primer forward: GT73-TmF" FT /note="GGGATGACGTTAATTGGCTCTG" FT /target="CTP2" FT primer_bind complement(39..65) FT /standard_name="RT-PCR probe: GT73-TmP" FT /note="FAM-CACGCCGTGGAAACAGAAGACATGACC-TAMRA" FT primer_bind complement(70..88) FT /standard_name="Primer reverse: GT73-TmR" FT /note="GGCTGCTTGCACCGTGAAG" FT /target="CP4-EPSPS" XX SQ Sequence 88 BP; 14 A; 23 C; 24 G; 27 T; 0 other; gggatgacgt taattggctc tgnnnnnnnn nnnnnnnngg tcatgtcttc tgtttccacg 60 gcgtgnnnnc ttcacggtgc aagcagcc 88 //