An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:ACS-GH001-3'
ID   QT-EVE-GH-002; SV 0; linear; genomic DNA; STS; SYN; 79 BP.
XX
AC   ACS-GH001-3;
XX
DT   02-FEB-2007
DT   17-NOV-2010
XX
DE   Quantitative PCR method for detection of cotton event LLCotton25
DE   (Mazzara et al., 2007).
XX
KW   event_specific.
XX
OS   Gossypium hirsutum (upland cotton) - event LLCotton25 (ACS-GH001-3)
XX
RN   [1]
RP   1-79
RA   Mazzara M., Grazioli E., Savini C., Van Den Eede G.;
RT   "Event-Specific Method for the Quantification of Cotton Line "LLCotton25" Using Real-time PCR - Validation Report and Protocol - Cotton Seeds Sampling and DNA Extraction";
RL   Online Publication (2007).
RX   DOI=10.2788/32755
XX
RN   [2]
RP   1-79
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-GH-002.pdf
XX
DR   GMOMETHODS; QT-TAX-GH-018;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..79
FT                   /standard_name="PCR 79 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of cotton event LLCotton25 and the cotton host genome"
FT   primer_bind     1..20
FT                   /standard_name="Primer forward: KVM156"
FT                   /note="CAAGGAACTATTCAACTGAG"
FT                   /target="5'-host genome"
FT   primer_bind     21..46
FT                   /standard_name="RT-PCR probe: TM018"
FT                   /note="FAM-CTTAACAGTACTCGGCCgTCGACCGC-TAMRA"
FT   primer_bind     complement(56..79)
FT                   /standard_name="Primer reverse: KVM155"
FT                   /note="CAGATTTTTGTGGGATTGGAATTC"
FT                   /target="insert"
XX
SQ   Sequence 79 BP; 23 A; 21 C; 12 G; 14 T; 9 other;
     caaggaacta ttcaactgag cttaacagta ctcggccgtc gaccgcnnnn nnnnngaatt        60
     ccaatcccac aaaaatctg                                                     79
//