An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-EVE-ZM-014; SV 0; linear; genomic DNA; STS; SYN; 101 BP.
XX
AC   MON-00021-9;
XX
DT   17-NOV-2007
DT   23-NOV-2010
XX
DE   Quantitative PCR method for detection of maize event GA21
DE   (Charles Delobel et al., 2007).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event GA21 (MON-00021-9)
XX
RN   [1]
RP   1-101
RA   Charles Delobel C., Larcher S., Savini C., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Maize Line GA21 Using Real-time PCR - Validation Report and Protocol - Report on the Verification of Performance of a DNA Extraction Method for Maize Grains";
RL   Online Publication (2007).
RX   DOI=10.2788/62889
XX
RN   [2]
RP   1-101
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-ZM-014.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-014;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..101
FT                   /standard_name="PCR 101 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5' integration border region (IBR) between the insert of maize event GA21 and the maize host genome"
FT   primer_bind     1..27
FT                   /standard_name="Primer forward: esGA21-5' forward primer"
FT                   /note="CGTTATGCTATTTGCAACTTTAGAACA"
FT                   /target="5'-host genome"
FT   primer_bind     46..71
FT                   /standard_name="RT-PCR probe: esGA21-5' probe"
FT                   /note="FAM-TTTCTCAACAGCAGGTGGGTCCGGGT-TAMRA"
FT   primer_bind     complement(85..101)
FT                   /standard_name="Primer reverse: esGA21-5' reverse primer"
FT                   /note="GCGATCCTCCTCGCGTT"
FT                   /target="insert"
XX
SQ   Sequence 101 BP; 17 A; 15 C; 20 G; 18 T; 31 other;
     cgttatgcta tttgcaactt tagaacannn nnnnnnnnnn nnnnntttct caacagcagg        60
     tgggtccggg tnnnnnnnnn nnnnaacgcg aggaggatcg c                           101
//