An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'id:qt-ele*&ft:cry1a(b)*'
ID   QT-ELE-00-003; SV 0; linear; genomic DNA; STS; SYN; 129 BP.
XX
AC   ;
XX
DT   29-MAY-2009
DT   21-SEP-2010
XX
DE   Quantitative PCR method for detection of synthetic cry1A(b) gene
DE   (ISO/FDIS 21570:2005).
XX
KW   element_specific.
XX
RN   [1]
RP   1-129
RT   "Foodstuffs - Methods of analysis for the detection of genetically
RT   modified organisms and derived products - Quantitative nucleic acid based
RT   methods";
RL   ISO 21570:1-103 (2005).
RX   ISO=34615
XX
RN   [2]
RP   1-129
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-ELE-00-003.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..129
FT                   /standard_name="PCR 129 bp amplicon"
FT                   /note="element-specific RT-PCR"
FT                   /target="synthetic cry1A(b) gene"
FT   primer_bind     1..21
FT                   /standard_name="Primer forward: CRY2-F"
FT                   /note="CCCATCGACATCAGCCTGAGC"
FT                   /target="cry1A(b)"
FT   primer_bind     22..109
FT                   /standard_name="RT-PCR probe: BTSYN"
FT                   /note="FAM-ATGTCCACCAGGCCCAGCACG-TAMRA"
FT   primer_bind     complement(110..129)
FT                   /standard_name="Primer reverse: CRY2-R"
FT                   /note="CAGGAAGGCGTCCCACTGGC"
FT                   /target="cry1A(b)"
XX
SQ   Sequence 129 BP; 7 A; 16 C; 11 G; 7 T; 88 other;
     cccatcgaca tcagcctgag cnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnng ccagtgggac       120
     gccttcctg                                                               129
//