Only one hit for query 'id%3aqt-ele*%26ft%3acry1a%28b%29*'
ID QL-ELE-00-027; SV 0; linear; genomic DNA; STD; SYN; 223 BP. XX AC ; XX DT 12-FEB-2007 DT 11-DEC-20017 XX DE Qualitative LAMP method for detection of phosphinothricin N-acetyltransferase (bar) gene (Li et al., 2018). XX KW element_specific. XX RN [1] RP 1-223 RA Li R., Shi J., Liu B., Zhang D., Zhao X., Yang L.; RT "International collaborative ring trial of four gene-specific loop-mediated isothermal amplification assays in GMO analysis"; RL Food Control 84:278-283 (2018). RX DOI=10.1016/j.foodcont.2017.08.012 XX RN [2] RP 1-223 RA Wang C., Li R., Quan S., Shen P., Zhang D., Shi J., Yang L.; RT "GMO detection in food and feed through screening by visual loop-mediated isothermal amplification assays"; RL Anal. and Bioanal. Chem. 407:4829-4834(2015). RX DOI=10.1007/s00216-015-8652-z XX RN [3] RP 1-223 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2017). RX PCR=QL-ELE-00-027.pdf XX FH Key Location/Qualifiers FH FT STS 1..223 FT /standard_name="LAMP 223 bp amplicon" FT /note="element-specific LAMP assay" FT /target="Phosphinothricin N-acetyltransferase (bar) gene from bacterium Streptomyces hygroscopicus" FT primer_bind 1..15 FT /standard_name="Primer forward: bar F3" FT /note="TGCATGCGCACGCTC" FT /target="bar" FT primer_bind join(21..36, complement(61..82)) FT /standard_name="Primer: bar FIP" FT /note="TGCTGAAGTCCCTGGAGGCACAGTTGGGCAGCCCGATG" FT primer_bind 21..36 FT /note="GTTGGGCAGCCCGATG" FT /target="bar F2" FT primer_bind complement(37..60) FT /standard_name="Primer: bar loop F (complementary to the sequence between F1 and F2)" FT /note="GGGCTTCAAGAGCGTGGTCGCTGT" FT primer_bind complement(61..82) FT /note="TGCTGAAGTCCCTGGAGGCACA" FT /target="bar F1c (complimentary to F1)" FT primer_bind join (121..139),complement(174..189)) FT /standard_name="Primer: bar BIP" FT /note="TGGCGGGGGGAGACGTACAGGGTCCCTGGAAGGCA" FT primer_bind 121..139 FT /note="TGGCGGGGGGAGACGTACA" FT /target="bar B1c (complementary to B1)" FT primer_bind 140..173 FT /standard_name="Primer: bar loop B (complementary to the sequence between B1 and B2) note in the amplicon sequence in position 144 FT is present a C nucleotide instead of the T nucleotide of the primer sequence" FT /note="CGGTTGACTCGGCCGTCCAGTCGTAGGCGTTGCG" FT primer_bind complement(174..189) FT /note="GGGTCCCTGGAAGGCA" FT /target="bar B2 (according to the sequence of the amplicon FT in position 186 the BIP primer present a complimentary T FT nucletide instead of a complementary C)" FT primer_bind complement(208..223) FT /standard_name="Primer reverse: bar B3" FT /note="AGGTGGACGGCGAGGT" FT /target="bar" XX SQ Sequence 223 BP; 30 A; 73 C; 81 G; 39 T; 0 other; tgcatgcgca cgctcnnnnn gttgggcagc ccgatgacag cgaccacgct cttgaagccc 60 tgtgcctcca gggacttcag cannnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 120 tggcgggggg agacgtacac ggtcgactcg gccgtccagt cgtaggcgtt gcgtgccttc 180 caggggcccn nnnnnnnnnn nnnnnnnacc tcgccgtcca cct 223 //