ID   QL-ELE-00-027; SV 0; linear; genomic DNA; STD; SYN; 223 BP.
XX
AC   ;
XX
DT   12-FEB-2007
DT   11-DEC-20017
XX
DE   Qualitative LAMP method for detection of phosphinothricin N-acetyltransferase (bar) gene (Li et al., 2018).
XX
KW   element_specific.
XX
RN   [1]
RP   1-223
RA   Li R., Shi J., Liu B., Zhang D., Zhao X., Yang L.;
RT   "International collaborative ring trial of four gene-specific loop-mediated isothermal amplification assays in GMO analysis";
RL   Food Control 84:278-283 (2018).
RX   DOI=10.1016/j.foodcont.2017.08.012
XX
RN   [2]
RP   1-223
RA   Wang C., Li R., Quan S., Shen P., Zhang D., Shi J., Yang L.;
RT   "GMO detection in food and feed through screening by visual loop-mediated isothermal amplification assays";
RL   Anal. and Bioanal. Chem.  407:4829-4834(2015).
RX   DOI=10.1007/s00216-015-8652-z
XX
RN   [3]
RP   1-223
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2017).
RX   PCR=QL-ELE-00-027.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..223
FT                   /standard_name="LAMP 223 bp amplicon"
FT                   /note="element-specific LAMP assay"
FT                   /target="Phosphinothricin N-acetyltransferase (bar) gene from bacterium Streptomyces hygroscopicus"
FT   primer_bind     1..15
FT                   /standard_name="Primer forward: bar F3"
FT                   /note="TGCATGCGCACGCTC"
FT                   /target="bar"
FT   primer_bind     join(21..36, complement(61..82))
FT                   /standard_name="Primer: bar FIP"
FT                   /note="TGCTGAAGTCCCTGGAGGCACAGTTGGGCAGCCCGATG"
FT   primer_bind     21..36
FT                   /note="GTTGGGCAGCCCGATG"
FT                   /target="bar F2"
FT   primer_bind     complement(37..60)
FT                   /standard_name="Primer: bar loop F (complementary to the sequence between F1 and F2)"
FT                   /note="GGGCTTCAAGAGCGTGGTCGCTGT"
FT   primer_bind     complement(61..82)
FT                   /note="TGCTGAAGTCCCTGGAGGCACA"
FT                   /target="bar F1c (complimentary to F1)"
FT   primer_bind     join (121..139),complement(174..189))
FT                   /standard_name="Primer: bar BIP"
FT                   /note="TGGCGGGGGGAGACGTACAGGGTCCCTGGAAGGCA"
FT   primer_bind     121..139
FT                   /note="TGGCGGGGGGAGACGTACA"
FT                   /target="bar B1c (complementary to B1)"
FT   primer_bind     140..173
FT                   /standard_name="Primer: bar loop B (complementary to the sequence between B1 and B2) note in the amplicon sequence in position 144
FT                   is present a C nucleotide instead of the T nucleotide of the primer sequence"
FT                   /note="CGGTTGACTCGGCCGTCCAGTCGTAGGCGTTGCG"
FT   primer_bind     complement(174..189)
FT                   /note="GGGTCCCTGGAAGGCA"
FT                   /target="bar B2 (according to the sequence of the amplicon
FT                   in position 186 the BIP primer present a complimentary T
FT                   nucletide instead of a complementary C)"
FT   primer_bind     complement(208..223)
FT                   /standard_name="Primer reverse: bar B3"
FT                   /note="AGGTGGACGGCGAGGT"
FT                   /target="bar"
XX
SQ   Sequence 223 BP; 30 A; 73 C; 81 G; 39 T; 0 other;
     tgcatgcgca cgctcnnnnn gttgggcagc ccgatgacag cgaccacgct cttgaagccc        60
     tgtgcctcca gggacttcag cannnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     tggcgggggg agacgtacac ggtcgactcg gccgtccagt cgtaggcgtt gcgtgccttc       180
     caggggcccn nnnnnnnnnn nnnnnnnacc tcgccgtcca cct                         223
//