An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)

Perform your search by keyword, select a GMO unique identifier or click a link in the section below.

Only one hit for query 'ac:DP-004114-3'
ID   QT-EVE-ZM-026; SV 0; linear; genomic DNA; STD; PLN; 80 BP.
AC   DP-004114-3;
DT   08-MAY-2018
DT   08-MAY-2018
DE   Quantitative PCR method for detection of maize event 4114 (EURL GMFF, 2018).
KW   event_specific.
OS   Zea mays (maize) - event 4114 (DP-004114-3)
RN   [1]
RP   1-80
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize DP-004114-3 Using Real-time PCR - Validation Report";
RL   Online Publication (2018).
RN   [2]
RP   1-80
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2018).
RX   PCR=QT-EVE-ZM-026.pdf
FH   Key             Location/Qualifiers
FT   STS             1..80
FT                   /standard_name="PCR 80 bp amplicon"
FT                   /note="Event-specific RT-PCR";
FT                   /target="5' integration border region
FT                   (IBR) between the insert of maize event 4114 and the maize host genome";
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: PHN164689"
FT                   /note="GCTTTGGAGCCTCTCGTTTGTA"
FT                   /target="5'-host genome"
FT   primer_bind     24..50
FT                   /standard_name="RT-PCR probe: PHN164691"
FT   primer_bind     complement(53..80)
FT                   /standard_name="Primer reverse: PHN1641690"
FT                   /target="insert"
SQ   Sequence 80 BP; 19 A; 21 C; 18 G; 22 T; 0 other;
     gctttggagc ctctcgtttg tancacttgc acgtagttac ccggaccgaa nnttcaacac        60
     agatctgata gtttaaacgc                                                    80