An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:MON-00603-6'
ID   QT-EVE-ZM-008; SV 0; linear; genomic DNA; STS; SYN; 108 BP.
XX
AC   MON-00603-6;
XX
DT   21-NOV-2005
DT   04-NOV-2010
XX
DE   Quantitative PCR method for detection of maize event NK603
DE   (Mazzara et al., 2005).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - Event NK603 (MON-00603-6) 
XX
RN   [1]
RP   1-108
RA   Mazzara M., Paoletti C., Puumalaainen J., Rasulo D., Van Den Eede G.;
RT   "Event-Specific Method for the Quantitation of Maize Line NK603 Using Real-Time PCR - Validation Report and Protocol";
RL   Online Publication (2005).
RX   BSHOP=LBNA21825
XX
RN   [2]
RP   1-108
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-ZM-008.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-011;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..108
FT                   /standard_name="108 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of maize event NK 603 and the maize host genome"
FT   primer_bind     1..27
FT                   /standard_name="Primer forward: NK603-F"
FT                   /note="ATGAATGACCTCGAGTAAGCTTGTTAA"
FT                   /target="insert"
FT   primer_bind     54..79
FT                   /standard_name="RT-PCR probe: NK603-PR"
FT                   /note="FAM-TGGTACCACGCGACACACTTCCACTC-TAMRA"
FT   primer_bind     complement(81..108)
FT                   /standard_name="Primer reverse: NK603-R"
FT                   /note="AAGAGATAACAGGATCCACTCAAACACT"
FT                   /target="3'-host genome"
XX
SQ   Sequence 108 BP; 19 A; 19 C; 17 G; 26 T; 27 other;
     atgaatgacc tcgagtaagc ttgttaannn nnnnnnnnnn nnnnnnnnnn nnntggtacc        60
     acgcgacaca cttccactcn agtgtttgag tggatcctgt tatctctt                    108
//