Only one hit for query 'ac%3aACS-BN001-4'
ID QT-TAX-BN-001; SV 0; linear; genomic DNA; STS; PLN; 129 BP. XX AC ; XX DT 03-JUL-2012 DT 05-OCT-2022 XX DE Quantitative PCR method for detection of oilseed rape acyl-ACP thioesterase gene (Jacchia et al., 2014) XX KW taxon_specific, validated_in_combination. XX OS Brassica napus (oilseed rape) XX RN [1] RP 1-129 RA Jacchia S., Bogni A., Mazzara M., Kreysa J.; RT "Event-specific Method for the Quantification of Oilseed Rape DP-073496-4 Using Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction from Oilseed Rape"; RL Online Publication (2014). RX EURL_GMFF=EURL-VL-02-12VR-EFSA-Corr1.pdf RX EURL_GMFF=EURL-VL-02-12VP-EFSA-Corr1.pdf XX RN [2] RP 1-129 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Oilseed Rape LBFLFK RT Locus1 and Locus2 Using Real-time PCR - Validation Report"; RL Online Publication (2022). RX EURL_GMFF=EURL-VL-02-19-VR.pdf RX EURL_GMFF=EURL-VL-02-19-VM.pdf XX RN [3] RP 1-129 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Oilseed Rape MON 94100 RT Using Real-time PCR - Validation Report"; RL Online Publication (2022). RX EURL_GMFF=EURL-VL-04-20-VR.pdf RX EURL_GMFF=EURL-VL-04-20-VM.pdf XX RN [4] RP 1-129 RT "See Cross-references below"; RL Online Publication (2014). XX DR GMOMETHODS; QT-EVE-BN-009; DR GMOMETHODS; QT-EVE-BN-012; DR GMOMETHODS; QT-EVE-BN-013; DR GMOMETHODS; QT-EVE-BN-014; XX FH Key Location/Qualifiers FH FT STS 1..129 FT /standard_name="PCR 126 bp amplicon" FT /note="taxon-specific RT-PCR for oilseed rape" FT /note="A novel A-genome specific oilseed rape PCR detection FT method for acyl-ACP thioesterase (FatA) gene in Brassica FT napus, Brassica rapa and Brassica juncea. The amplified FatA(A) fragment is 126 bp (missing the NNN nucleotides in the 129 bp amplicon below) in a majority of Brassica napus varieties, in all Brassica juncea varieties and in some of the Brassica rapa varieties tested; it is of 129 bp in a minority of Brassica napus varieties and in some Brassica rapa varieties tested.; FT /target="acyl-ACP thioesterase (FatA) gene" FT primer_bind 1..24 FT /standard_name="Primer forward: 09-0-3249" FT /note="ACAGATGAAGTTCGGGACGAGTAC" FT /target="FatA" FT primer_bind 54..73 FT /standard_name="RT-PCR probe: 09-QP-87" FT /note="FAM-AAGAAGAATCATCATGCTTC-MGBNFQ" FT N_region 77..79 FT /note="'N' bases represent oligonucleotide sequences generally missing FT in B. napus, B. rapa and B. FT juncea." FT primer_bind complement(103..129) FT /standard_name="Primer reverse: 09-0-3251" FT /note="CAGGTTGAGATCCACATGCTTAAATAT" FT /target="FatA" XX SQ Sequence 129 BP; 37 A; 22 C; 27 G; 38 T; 5 other; acagatgaag ttcgggacga gtacnnnnnn nnnnnnnnnn nnnnnnnnnn nnnaagaaga 60 atcatcatgc ttcnnnNNNn nnnnnnnnnn nnnnnnnnnn nnatatttaa gcatgtggat 120 ctcaacctg 129 //