An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-EVE-BN-006; SV 0; linear; genomic DNA; STS; SYN; 113 BP.
XX
AC   ACS-BN001-4;
XX
DT   22-NOV-2011
DT   13-JUN-2007
XX
DE   Quantitative PCR method for detection of oilseed rape event RF1 (verified by the EU-RL GMFF in the context of Commission Decision 2007/305/EC)
XX
KW   event_specific, EU-RL_GMFF_in-house_verified.
XX
OS   Brassica napus (oilseed rape) - event RF1 (ACS-BN001-4)
XX
RN   [1]
RP   1-113
RA   Mazzara M.,;
RT   "In-house Validation of an Event-specific Method for the Quantification of Oilseed Rape RF1 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2011).
RX   EURL_GMFF=CRLVL0904 VR.pdf
RX   EURL_GMFF=CRLVL0904 VP.pdf
XX
RN   [2]
RP   1-113
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2011).
RX   PCR=QT-EVE-BN-006.pdf
XX
DR   GMOMETHODS; QT-TAX-BN-012;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..113
FT                   /standard_name="PCR 113 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5'integration border region (IBR) between the insert of oilseed rape event RF1 and the oilseed rape host genome";
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: MDB118"
FT                   /note="CTAAGGGAGGTCAAGATGTAGC"
FT                   /target="5'-host genome"
FT   primer_bind     66..92
FT                   /standard_name="RT-PCR probe: TM022"
FT                   /note="FAM-CTCATCATCCTCACCCAGTCAGCATCA-TAMRA"
FT   primer_bind     complement(94..113)
FT                   /standard_name="Primer reverse: KVM170"
FT                   /note="CGGGCCTAACTTTTGGTGTG"
FT                   /target="insert"
XX
SQ   Sequence 113 BP; 31 A; 35 C; 23 G; 24 T; 0 other;
     ctaagggagg tcaagatgta gcnnnnnnnn aacccttttc catcttttcc ggtgactaca        60
     nnnnnctcat catcctcacc cagtcagcat cancacacca aaagttaggc ccg              113
//