An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:SYN-05307-1'
ID   QT-EVE-ZM-002; SV 0; linear; genomic DNA; STS; SYN; 107 BP.
XX
AC   SYN-05307-1;
XX
DT   24-MAY-2011
DT   03-FEB-2015
XX
DE   Quantitative PCR method for detection of maize event 5307(EURL GMFF, 2014).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event 5307 (SYN-05307-1)
XX
RN   [1]
RP   1-107
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize 5307 by Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2014).
RX   EURL_GMFF=EURL-VL-07-11VR_Maize 5307 final report.pdf
RX   EURL_GMFF=2014-12-05_VP_EURL-VL-07-11FINAL.pdf
XX
RN   [2]
RP   1-107
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2014).
RX   PCR=QT-EVE-ZM-002.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-014;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..107
FT                   /standard_name="PCR 107 bp amplicon"
FT                   /note="Event-specific RT-PCR";
FT                   /target="3' integration border region (IBR) between the insert of maize event 5307 and the maize host genome";
FT   primer_bind     1..21
FT                   /standard_name="Primer forward: 5307i3' forward primer" 
FT                   /note="CATGGCCGTATCCGCAATGTG"
FT                   /target="insert"
FT   primer_bind     54..82
FT                   /standard_name="RT-PCR probe: 5307i3'-s2 probe"
FT                   /note="FAM-ACCACAATATACCCTCTTCCCTGGGCCAG-TAMRA"
FT   primer_bind     complement(90..107)
FT                   /standard_name="Primer reverse: 5307i3' reverse primer"
FT                   /note="TGCACCCTTTGCCAGTGG"
FT                   /target="3'-host genome"
XX
SQ   Sequence 107 BP; 24 A; 29 C; 25 G; 29 T; 0 other;
     catggccgta tccgcaatgt gnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnaccacaa        60
     tataccctct tccctgggcc agnnnnnnnc cactggcaaa gggtgca                     107
//