An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:MON-87460-4'
ID   QT-EVE-ZM-005; SV 0; linear; genomic DNA; STS; SYN; 82 BP.
XX
AC   MON-87460-4;
XX
DT   16-APR-2009
DT   07-FEB-2012
XX
DE   Quantitative PCR method for detection of maize event MON87460 (Savini et al., 2011)
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event MON87460 (MON-87460-4)
XX
RN   [1]
RP   1-82
RA   Savini C., Mazzara M., Pinski G., Van den Eede G.;
RT   "Event-specific Method for the Quantification of Maize MON87460 Using Real-time PCR -Validation Report and Validated Method";
RL   Online Publication (2012).
RX   DOI=10.2788/45380
XX
RN   [2]
RP   1-82
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2012).
RX   PCR=QT-EVE-ZM-005.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..82
FT                   /standard_name="PCR 82 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5'integration border region (IBR) between the insert of maize event MON87460 and the maize host genome";
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: MON 87460 primer 1"
FT                   /note="CACGTTGAAGGAAAATGGATTG"
FT                   /target="5'-host genome"
FT   primer_bind     24..61
FT                   /standard_name="RT-PCR probe: MON 87460 Probe"
FT                   /note="FAM-
FT                   AGGGAGTATGTAGATAAATTTTCAAAGCGTTAGACGGC-TAMRA"
FT   primer_bind     complement(63..82)
FT                   /standard_name="Primer reverse: MON 87460 Primer 2"
FT                   /note="TCGCGATCCTCCTCAAAGAC"
FT                   /target="insert"
XX
SQ   Sequence 82 BP; 25 A; 9 C; 27 G; 21 T; 0 other;
     cacgttgaag gaaaatggat tgnagggagt atgtagataa attttcaaag cgttagacgg        60
     cngtctttga ggaggatcgc ga                                                 82
//