An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-TAX-BN-003; SV 0; linear; genomic DNA; STS; PLN; 101 BP.
XX
AC   ;
XX
DT   14-FEB-2019
DT   05-DEC-2011
XX
DE   Quantitative PCR  method for detection of oilseed rape cruciferin A gene (Jacchia et al., 2019)
XX
KW   taxon_specific, validated_in_combination.
XX
OS   Brassica napus (oilseed rape)
XX
RN   [1]
RP   1-101
RA   Jacchia S., Sacco M.G., Savini C., Mazzara M., Emons H.;
RT   "Event-specific Method for the Quantification of Oilseed Rape MS11 Using
RT   Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2019).
RX   EURL_GMFF=EURL-VL-03-16-VR.pdf
RX   EURL_GMFF=EURL-VL-03-16-VM.pdf
XX
RN   [2]
RP   1-101
RT   "See Cross-references below";
RL   Online Publication (2019).
XX
DR   GMOMETHODS; QT-EVE-BN-011;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             complement(1..101)
FT                   /standard_name="PCR 101 bp amplicon"
FT                   /note="taxon-specific RT-PCR for oilseed rape"
FT                   /target="cruciferin A (CruA) gene"
FT   primer_bind     1..18
FT                   /standard_name="Primer forward: MDB510"
FT                   /note="GGCCAGGGTTTCCGTGAT"
FT                   /target="CruA"
FT   primer_bind     complement(20..48)
FT                   /standard_name="RT-PCR probe: TM458"
FT                   /note="JOE-AGTCCTTATGTGCTCCACTTTCTGGTGCA-BHQ1"
FT   primer_bind     complement(81..101)
FT                   /standard_name="Primer reverse: MDB511"
FT                   /note="CCGTCGTTGTAGAACCATTGG"
FT                   /target="CruA"
XX
SQ   Sequence 101 BP; 19 A; 16 C; 20 G; 13 T; 33 other;
     ggccagggtt tccgtgatnt gcaccagaaa gtggagcaca taaggactnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn ccaatggttc tacaacgacg g                           101
//