European Commission > EU Science Hub > EURL GMFF
Legal Notice   Privacy statement   English (EN)
Welcome to the GMOMETHODS application

GMOMETHODS provides information on EU reference methods for GMO Analysis.

The assays are DNA-based detection methods that have been validated in a collaborative study according to ISO 5725 and/or the International Union of Pure and Applied Chemistry (IUPAC) requirements. In alternative, the assays have been verified by the EURL GMFF for EU legal purposes. Data are retrieved from peer-reviewed journals and final reports of collaborative studies.

The application assists control laboratories in selecting appropriate methods for GMO analysis, supplies core data on the experimental protocol and information on methods performance, ring-trial design, plasmid standards, reference materials and links to published articles or validation reports.


Perform your search by inserting a key word or by selecting a GMO unique identifier.


Only one hit for query 'ac:MON-00603-6'
ID   QT-EVE-ZM-008; SV 0; linear; genomic DNA; STS; SYN; 108 BP.
XX
AC   MON-00603-6;
XX
DT   21-NOV-2005
DT   04-NOV-2010
XX
DE   Quantitative PCR method for detection of maize event NK603
DE   (Mazzara et al., 2005).
XX
KW   event_specific.
XX
OS   Zea mays (maize) - Event NK603 (MON-00603-6) 
XX
RN   [1]
RP   1-108
RA   Mazzara M., Paoletti C., Puumalaainen J., Rasulo D., Van Den Eede G.;
RT   "Event-Specific Method for the Quantitation of Maize Line NK603 Using Real-Time PCR - Validation Report and Protocol";
RL   Online Publication (2005).
RX   BSHOP=LBNA21825
XX
RN   [2]
RP   1-108
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-ZM-008.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-011;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..108
FT                   /standard_name="108 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of maize event NK 603 and the maize host genome"
FT   primer_bind     1..27
FT                   /standard_name="Primer forward: NK603-F"
FT                   /note="ATGAATGACCTCGAGTAAGCTTGTTAA"
FT                   /target="insert"
FT   primer_bind     54..79
FT                   /standard_name="RT-PCR probe: NK603-PR"
FT                   /note="FAM-TGGTACCACGCGACACACTTCCACTC-TAMRA"
FT   primer_bind     complement(81..108)
FT                   /standard_name="Primer reverse: NK603-R"
FT                   /note="AAGAGATAACAGGATCCACTCAAACACT"
FT                   /target="3'-host genome"
XX
SQ   Sequence 108 BP; 19 A; 19 C; 17 G; 26 T; 27 other;
     atgaatgacc tcgagtaagc ttgttaannn nnnnnnnnnn nnnnnnnnnn nnntggtacc        60
     acgcgacaca cttccactcn agtgtttgag tggatcctgt tatctctt                    108
//