Only one hit for query 'ac%3AMON-00603-6'
ID QT-TAX-ZM-006; SV 0; linear; genomic DNA; STS; PLN; 151 BP. XX AC ; XX DT 15-SEP-2009 DT 16-SEP-2010 XX DE Quantitative PCR method for detection of maize starch synthase IIb gene XX KW taxon_specific, validated_in_combination. XX OS Zea mays (maize) XX RN [1] RP 1-151 RA Shindo Y., Kuribara H., Matsuoka T., Futo S., Sawada C., Shono J., RA Akiyama H., Goda Y., Toyoda M., Hino A.; RT "Validation of real-time PCR analyses for line-specific quantitation of RT genetically modified maize and soybean using new reference molecules"; RL J AOAC Int 85:1119-1126 (2002). RX PUBMED; 12374412. XX RN [2] RP 1-151 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Quantitative nucleic acid based RT methods"; RL ISO 21570:1-103 (2005). RX ISO=34615 XX RN [3] RP 1-151 RT "See Cross-references below"; RL Online Publication (2010). XX DR GMOMETHODS; QT-CON-00-006; DR GMOMETHODS; QT-CON-00-007; DR GMOMETHODS; QT-CON-00-004; DR GMOMETHODS; QT-CON-00-005; DR GMOMETHODS; QT-CON-00-008; XX FH Key Location/Qualifiers FH FT STS 1..151 FT /standard_name="PCR 151 bp amplicon" FT /note="Taxon-specific RT-PCR for maize" FT /target="maize starch synthase IIb (zSSIIb) gene" FT primer_bind 1..22 FT /standard_name="Primer forward: SSllb 1-5'" FT /note="CTCCCAATCCTTTGACATCTGC" FT /target="zSSIIb" FT primer_bind 28..52 FT /standard_name="RT-PCR probe: SSIIb-Taq" FT /note="FAM-AGCAAAGTCAGAGCGCTGCAATGCA-TAMRA" FT primer_bind complement(129..151) FT /standard_name="Primer reverse: SSIIb 1-3'" FT /note="TCGATTTCTCTCTTGGTGACAGG" FT /target="zSSIIb" XX SQ Sequence 151 BP; 41 A; 48 C; 40 G; 22 T; 0 other; ctcccaatcc tttgacatct gcnnnnnagc aaagtcagag cgctgcaatg cannnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 120 nnnnnnnncc tgtcaccaag agagaaatcg a 151 //