An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)

Perform your search by keyword, select a GMO unique identifier or click a link in the section below.

Only one hit for query 'ac:BCS-GH002-5'
ID   QT-EVE-GH-006; SV 0; linear; genomic DNA; STS; SYN; 120 BP.
AC   BCS-GH002-5;
DT   09-JAN-2008
DT   23-NOV-2010
DE   Quantitative PCR method for detection of cotton event GHB614
DE   (Savini et al., 2008).
KW   event_specific.
OS   Gossypium hirsutum (upland cotton) - event GHB614 (BCS-GH002-5)
RN   [1]
RP   1-120
RA   Savini C., Bogni A., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Cotton Line GHB614 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/43697
RN   [2]
RP   1-120
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QT-EVE-GH-006.pdf
FH   Key             Location/Qualifiers
FT   STS             1..120
FT                   /standard_name="PCR 120 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="3' integration border region (IBR) between the insert of cotton event GHB614 and the cotton host genome"
FT   primer_bind     1..24
FT                   /standard_name="Primer forward: SHA007"
FT                   /note="CAAATACACTTGGAACGACTTCGT"
FT                   /target="insert"
FT   primer_bind     31..60
FT                   /standard_name="RT-PCR probe: TM072"
FT                   /note="The probe sequence provided by the applicant is missing a nucleotide at position 51 of the amplicon according to patent sequence accession no. CS492094"
FT   primer_bind     complement(100..120)
FT                   /standard_name="Primer reverse: SHA008"
FT                   /note="GCAGGCATGCAAGCTTTTAAA"
FT                   /target="3'-host genome"
SQ   Sequence 120 BP; 20 A; 19 C; 14 G; 22 T; 45 other;
     caaatacact tggaacgact tcgtnnnnnn ctccatggcg atcgctacgt ntctagaatt        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnt ttaaaagctt gcatgcctgc       120