Only one hit for query 'ac:BCS-GH002-5'
ID QL-ELE-00-016; SV 1; linear; other DNA; STD; SYN; 74 BP. XX AC ; XX DT 15-JUL-2008 DT 10-MAY-2017 XX DE Qualitative PCR method for detection of cry1Ab/Ac gene XX KW element_specific. RN [1] RP 1-74 RA Grohmann L., Reiting R., Maede D., Uhlig S., Simon K., Frost K., RA Jit Randhawa G., Zur K.; RT "Collaborative trial validation of cry1Ab/Ac and Pubi-cry TaqMan-based real-time PCR assays for detection of DNA derived from genetically modified Bt plant products"; RL Accred Qual Assur 20:85-96 (2015). RX DOI=10.1007/s00769-015-1108-5 XX RN [2] RP 1-74 RT "Detection of genetically modified cry1Ab/Ac and P-ubi-cry DNA sequences in rice products using real-time PCR"; RL BVL L 15.06-3:2013-08 (2013). RX BVL=bvl-l-1506-3/193413251 XX RN [3] RP 1-74 RT "Horizontal methods for molecular biomarker analysis -- Methods of analysis for the detection of genetically modified organisms and derived products -- Part 6: Real-time PCR based screening methods for the detection of cry1Ab/Ac and Pubi-cry DNA sequences"; RL ISO/TS 21569-6:2016 (2016). RX ISO=69356 XX RN [4] RP 1-74 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2014). RX PCR=QL-ELE-00-016.pdf XX FH Key Location/Qualifiers FH FT STS 1..74 FT /standard_name="PCR 74 bp amplicon" FT /note="element-specific RT-PCR" FT /target="cry1Ab/Ac synthetic construct derived from Bacillus thuringiensis" FT primer_bind 1..24 FT /standard_name="Primer forward: Bt-F1" FT /note="GAGGAAATGCGTATTCAATTCAAC" FT /target="cry1Ab/Ac" FT primer_bind 26..50 FT /standard_name="RT-PCR probe: Bt-P" FT /note="FAM-ACATGAACAGCGCCTTGACCACAGC-NFQ" FT primer_bind complement(55..74) FT /standard_name="Primer reverse: Bt-R" FT /note="TTCTGGACTGCGAACAATGG" FT /target="cry1Ab/Ac" XX SQ Sequence 74 BP; 23 A; 20 C; 15 G; 16 T; 0 other; gaggaaatgc gtattcaatt caacnacatg aacagcgcct tgaccacagc nnnnccattg 60 ttcgcagtcc agaa 74 //