ID QT-EVE-GH-006; SV 0; linear; genomic DNA; STS; SYN; 120 BP. XX AC BCS-GH002-5; XX DT 09-JAN-2008 DT 23-NOV-2010 XX DE Quantitative PCR method for detection of cotton event GHB614 DE (Savini et al., 2008). XX KW event_specific. XX OS Gossypium hirsutum (upland cotton) - event GHB614 (BCS-GH002-5) XX RN [1] RP 1-120 RA Savini C., Bogni A., Mazzara M., Van Den Eede G.; RT "Event-specific Method for the Quantification of Cotton Line GHB614 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2008). RX DOI=10.2788/43697 XX RN [2] RP 1-120 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-GH-006.pdf XX DR GMOMETHODS; QT-TAX-GH-019; XX FH Key Location/Qualifiers FH FT STS 1..120 FT /standard_name="PCR 120 bp amplicon" FT /note="event-specific RT-PCR" FT /target="3' integration border region (IBR) between the insert of cotton event GHB614 and the cotton host genome" FT primer_bind 1..24 FT /standard_name="Primer forward: SHA007" FT /note="CAAATACACTTGGAACGACTTCGT" FT /target="insert" FT primer_bind 31..60 FT /standard_name="RT-PCR probe: TM072" FT /note="FAM-CTCCATGGCGATCGCTACGTTCTAGAATT-TAMRA" FT /note="The probe sequence provided by the applicant is missing a nucleotide at position 51 of the amplicon according to patent sequence accession no. CS492094" FT primer_bind complement(100..120) FT /standard_name="Primer reverse: SHA008" FT /note="GCAGGCATGCAAGCTTTTAAA" FT /target="3'-host genome" XX SQ Sequence 120 BP; 20 A; 19 C; 14 G; 22 T; 45 other; caaatacact tggaacgact tcgtnnnnnn ctccatggcg atcgctacgt ntctagaatt 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnt ttaaaagctt gcatgcctgc 120 //