ID   QL-ELE-00-016; SV 1; linear; other DNA; STD; SYN; 74 BP.
XX
AC   ;
XX
DT   15-JUL-2008
DT   10-MAY-2017
XX
DE   Qualitative PCR method for detection of cry1Ab/Ac gene
XX
KW   element_specific.
RN   [1]
RP   1-74
RA   Grohmann L., Reiting R., Maede D., Uhlig S., Simon K., Frost K.,
RA   Jit Randhawa G., Zur K.;
RT   "Collaborative trial validation of cry1Ab/Ac and Pubi-cry TaqMan-based real-time PCR assays for detection of DNA derived from genetically modified Bt plant products";
RL   Accred Qual Assur 20:85-96 (2015).
RX   DOI=10.1007/s00769-015-1108-5
XX
RN   [2]
RP   1-74
RT   "Detection of genetically modified cry1Ab/Ac and P-ubi-cry DNA sequences in rice products using real-time PCR";
RL   BVL L 15.06-3:2013-08 (2013).
RX   BVL=bvl-l-1506-3/193413251
XX
RN   [3]
RP   1-74
RT   "Horizontal methods for molecular biomarker analysis -- Methods of analysis for the detection of genetically modified organisms and derived products -- Part 6: Real-time PCR based screening methods for the detection of cry1Ab/Ac and Pubi-cry DNA sequences";
RL   ISO/TS 21569-6:2016 (2016).
RX   ISO=69356
XX
RN   [4]
RP   1-74
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2014).
RX   PCR=QL-ELE-00-016.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..74
FT                   /standard_name="PCR 74 bp amplicon"
FT                   /note="element-specific RT-PCR"
FT                   /target="cry1Ab/Ac synthetic construct derived from Bacillus thuringiensis"
FT   primer_bind     1..24
FT                   /standard_name="Primer forward: Bt-F1"
FT                   /note="GAGGAAATGCGTATTCAATTCAAC"
FT                   /target="cry1Ab/Ac"
FT   primer_bind     26..50
FT                   /standard_name="RT-PCR probe: Bt-P"
FT                   /note="FAM-ACATGAACAGCGCCTTGACCACAGC-NFQ"
FT   primer_bind     complement(55..74)
FT                   /standard_name="Primer reverse: Bt-R"
FT                   /note="TTCTGGACTGCGAACAATGG"
FT                   /target="cry1Ab/Ac"
XX
SQ   Sequence 74 BP; 23 A; 20 C; 15 G; 16 T; 0 other;
     gaggaaatgc gtattcaatt caacnacatg aacagcgcct tgaccacagc nnnnccattg        60
     ttcgcagtcc agaa                                                          74
//