An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QL-TAX-DC-001; SV 0; linear; genomic DNA; STS; PLN; 1279 BP.
XX
AC   ;
XX
DT   20-SEP-2012
DT   15-DEC-2017
XX
DE   Qualitative PCR method for detection of carnation anthocyanidin synthase gene.  
XX
KW   taxon_specific, validated_in_combination.
XX
OS   Dianthus caryophyllus (carnation)
XX
RN   [1]
RP   1-1279
RA   Savini C., Querci M., Moens W., Mazzara M., Cordeil S., Van den Eede G.;
RT   "Report on the Testing of a PCR-based Detection Method for Identification
RT   of FlorigeneTM Moonlite GM Carnation - Protocol Version 2";
RL   Online Publication (2007).
RX   EURL_2001=CRL_Report_Flor_Moonlite_v2.pdf
XX
RN   [2]
RP   1-1279
RA   Savini C., Brustio R., Bogni A., Mazzara M., Kreysa J.;
RT   "Report on the single-laboratory validation of a PCR-based Detection Method for Identification of FlorigeneTM IFD-25958-3 GM Carnation - Validation Report and Validated Method";
RL   Online Publication (2012).
RX   DOI=10.2788/76760
XX
RN   [3]
RP   1-1279
RA   Savini C., Pinski G., Mazzara M., Kreysa J.;
RT   "Report on the Single-laboratory Validation of a PCR-based Detection Method for Identification of FlorigeneTM 26407 GM Carnation - Validation Report and Validated Method";
RL   Online Publication (2013).
RX   DOI=10.2788/34771
XX
RN   [4]
RP   1-1279
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Report on the Single-laboratory Validation of a PCR-based Detection Method for Identification of SHD-27531-4 GM Carnation - JRC Validated Methods, Reference Methods and Measurement Reports";
RL   Online Publication (2016).
RX   EURL_2001=EURL-EV-01-13-Final-Report.pdf
XX
RN   [5]
RP   1-1279
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Report on the Single-laboratory Validation of a PCR-based Detection Method for Identification of GM-line FLO-40685-2 Carnation - JRC Validated Methods, Reference Methods and Measurement Reports";
RL   Online Publication (2016).
RX   EURL_2001=EURL-EV-02-13-VR.pdf
XX
RN   [6]
RP   1-1279
RT   "See Cross-references below";
RL   Online Publication (2016).
XX
DR   GMOMETHODS; QL-EVE-DC-001;
DR   GMOMETHODS; QL-EVE-DC-003;
DR   GMOMETHODS; QL-EVE-DC-004;
DR   GMOMETHODS; QL-EVE-DC-005;
DR   GMOMETHODS; QL-EVE-DC-006;
XX
FH   Key             Location/Qualifiers
FH
FT                   /note="This sequence has been obtained by manual
FT                   annotation of record GenBank:AB727362.2, Dianthus
FT                   caryophyllus genomic DNA, anthocyanidin synthase promoter
FT                   region. "
FT   STS             1..1279
FT                   /standard_name="PCR 1279 bp amplicon"
FT                   /note="taxon-specific PCR for carnation";
FT                   /target="anthocyanidin synthase gene"
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: ANS.F"
FT                   /note="CTAGATCGGAGGTCACCATACC"
FT                   /target="ANS"
FT   primer_bind     complement(1259..1279)
FT                   /standard_name="Primer reverse: ANS.R"
FT                   /note="GAAACCGTGACCATGGTCTCG"
FT                   /target="ANS"
XX
SQ   Sequence 1279 BP; 352 A; 250 C; 272 G; 405 T; 0 other;
     ctagatcgga ggtcaccata cccgtgaaga tttttctgtg agaggaaaag aacccaagga        60
     cgaggttcaa atctacacat ggaaagacgc cacgcttcgt gagttaactg accttgtatg       120
     tcgccatcgc ttagcgtagc gctgaacatc gttttcaccc tgctccatcc atcaaccatt       180
     tattggtctt atacatgtgt gattgcgttg ttcttacatt taggtgaaag acgtttctcc       240
     agctgctagg agtcgagatg cgaaattgtc gtttgcgact gtataccttg atagaaatgg       300
     atgcatgcaa gtaaagaagg tatcttctaa ttcatctttc gtagagacat agcgtgaatt       360
     tggacggggt ctttggtttg agaaagataa cagctttacg tatttttgta gatgggtgaa       420
     accttttcaa atccgtataa gcgtaaagac gacaactggg ctttagggga cacattcttt       480
     caggtataat tgatgcgact aacaatagtc tccactgatc atattctact cttctacgtt       540
     cgatactgac tgtttctggt tatttggtag acaggagatt atttggacgt agcaattcag       600
     tagcgtagag atgtttccac acgtgttatc gtaaaagaag caagataagc ctaatgccta       660
     gggtggtggt atgacttccg ttgcttatcg atcgtgcttg taagtaattt ccgtcttatc       720
     ttttcctgtt atataaagtt aatcttctct aggactttca tgaaccttgt ttgtgtattt       780
     atttctcgat caacatgata gagctagttt ttaagcaacg tatactagta gtctattgga       840
     agttaagaca cggttcttaa aaaggtacga tccaagtgaa gcatgttaga tatgacactt       900
     tcttctaggg acgactctcg tatgccaccc gactttttca attttttttg tgaatgttag       960
     atgtgtgtat ataatgcatc cgaaagatgt ctcaacgaac aaatgagcca cctacttcga      1020
     tcactcgcta tcaatgttat taatgccttg ttgattttaa tagttgatca ataatagtaa      1080
     aatctattca agggtatagt ctcccgttca cactcatcgg ggttacacta gcgagctcca      1140
     ttaatcggtg ccttaatcga gacgctaaga actataccat gacctagtca gcgccatggg      1200
     actgatgtag gccacacaat ctcgatgatc cgaaaacgct agagttcaag acctagttcg      1260
     agaccatggt cacggtttc                                                   1279
//