An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QL-CON-00-004; SV 0; linear; genomic DNA; STS; SYN; 211 BP.
XX
AC   SYN-EV176-9;
XX
DT   23-JUN-2009
DT   05-OCT-2016
XX
DE   Qualitative PCR method for detection of the junction between the CDPK promoter from maize and the synthetic cry1A(b) gene (ISO/FDIS 21569:2005).
XX
KW   construct_specific.
XX
OS   Zea mays (maize) - event Bt176 (SYN-EV176-9)
XX
RN   [1]
RP   1-211
RT   "Foodstuffs - Methods of analysis for the detection of genetically
RT   modified organisms and derived products - Qualitative nucleic acid based
RT   methods";
RL   ISO 21569:1-69 (2005).
RX   ISO=34614
XX
RN   [2]
RP   1-211
RT   "Detection of a genetic modification of maize (Zea mays L.) by
RT   amplification of the modified DNA sequence by means of the polymerase
RT   chain reaction (PCR) and hybridization of the PCR product with a DNA
RT   probe or restriction analysis of the PCR product, N. L 15.05-1";
RL   Online Publication (2002).
XX
RN   [3]
RP   1-211
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2010).
RX   PCR=QL-CON-00-004.pdf
XX
DR   GMOMETHODS; QL-TAX-ZM-003;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..211
FT                   /standard_name="PCR 211 bp amplicon"
FT                   /note="Construct-specific PCR"
FT                   /target="Junction region between the calcium-dependent protein kinase promoter (P-CDPK) from maize and the synthetic cry1A(b) gene"
FT   primer_bind     1..20
FT                   /standard_name="Primer forward: Cry03"
FT                   /note="CTCTCGCCGTTCATGTCCGT"
FT                   /target="P-CDPK"
FT   primer_bind     complement(192..211)
FT                   /standard_name="Primer reverse: Cry04"
FT                   /note="GGTCAGGCTCAGGCTGATGT"
FT                   /target="cry1A(b)"
XX
SQ   Sequence 211 BP; 6 A; 16 C; 8 G; 10 T; 171 other;
     ctctcgccgt tcatgtccgt nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       180
     nnnnnnnnnn nacatcagcc tgagcctgac c                                      211
//