Perform your search by keyword, select a GMO unique identifier or click a link in the section below.

ID   QT-TAX-ZM-002; SV 0; linear; genomic DNA; STS; PLN; 79 BP.
AC   ;
DT   29-MAY-2009
DT   14-FEB-2024
DE   Quantitative PCR method for detection of maize high-mobility-group gene
KW   taxon_specific, validated_in_combination.
OS   Zea mays (maize)
RN   [1]
RP   1-79
RT   "Foodstuffs - Methods of analysis for the detection of genetically
RT   modified organisms and derived products - Quantitative nucleic acid based
RT   methods";
RL   ISO 21570:1-103 (2005).
RX   ISO=34615
RN   [2]
RP   1-79
RA   Mazzara M., Grazioli E., Savini C., Van Den Eede G.;
RT   "Report on the Verification of the Performance of a MON810 Event-specific Method on Maize Line MON810 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2009).
RX   DOI=10.2788/59036
RN   [3]
RP   1-79
RA   Mazzara M., Foti N., Price S., Paoletti C., Van Den Eede G.;
RT   "Event-Specific Method for the Quantitation of Maize Line TC1507 Using Real-Time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Maize TC15O7";
RL   Online Publication (2005).
RN   [4]
RP   1-79
RA   Mazzara M., Grazioli E., Larcher S., Savini C., Van Den Eede G.;
RT   "Event-Specific Method for the Quantitation of Maize Line DAS-59122-7 Using Real-Time PCR - Validation Report and Protocol";
RL   Online Publication (2006).
RX   DOI=10.2788/31820
RN   [5]
RP   1-79
RA   Charles Delobel C., Grazioli E., Larcher S., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Maize Line LY038 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/43570
RN   [6]
RP   1-79
RA   Charles Delobel C., Foti N., Grazioli E., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Maize Line MON88017 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/43272
RN   [7]
RP   1-79
RA   Savini C., Bogni A., Grazioli E., Munaro B., Mazzara M., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Maize Line MON89034 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2008).
RX   DOI=10.2788/68713
RN   [8]
RP   1-79
RA   Savini C., ;
RT   "Event-specific Method for the Quantification of Maize 98140 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2011).
RX   EURL_GMFF=DP-098140-6_validated_Method.pdf
RX   EURL_GMFF=DP-098140-6_val_report.pdf
RN   [9]
RP   1-79
RA   Savini C.,;
RT   "Event-specific Method for the Quantification of Maize MON87460 Using Real-time PCR. Validation Report and Protocol";
RL   Online Publication (2012).
RX   EURL_GMFF=2012-01-27_MON87460_validated_Method.pdf
RX   EURL_GMFF=2012-01-27_MON87460_val_report.pdf
RN   [10]
RP   1-79
RA   Savini C.,;
RT   "Event-specific Method for the Quantification of Maize DAS-40278-9 by Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Maize TC15O7";
RL   Online Publication (2012).
RX   EURL_GMFF=2012-08-15_EURL-VL-10-10 VM_JRC76621
RX   EURL_GMFF=2012-08-13_EURL-VL-10 10 VR_JRC76621
RN   [11]
RP   1-79
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize MON 87427 Using Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2015).
RN   [12]
RP   1-79
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize MON87411 Using Real-time PCR - Validation Report and Validated Method";
RL   Online Publication (2016).
RN   [13]
RP   1-79
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize MON 87403 Using Real-time PCR - Validation Report";
RL   Online Publication (2018).
RN   [14]
RP   1-79
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize MON 87419 Using Real-time PCR";   
RL   Online Publication (2019).
RX   EURL_GMFF=EURL-VL-02_17_VR_MON87419.pdf
RX   EURL_GMFF=EURL-VL-02_17_VM_MON87419.pdf
RN   [15]
RP   1-79
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Maize MON 87429 Using Real-time PCR - Validation Report";   
RL   Online Publication (2021).
RN   [16]
RP   1-79
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT  "Event-specific Method for the Quantification of Maize MON 95379 Using Real-time PCR - Validation Report"; 
RL   Online Publication (2022).
RN   [17]
RP   1-79
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT  "Event-specific Method for the Quantification of Maize MON 95275 Using Real-time PCR -
RT   Validation Report"; 
RL   Online Publication (2023).
RN   [18]
RP   1-79
RT   "See Cross-references below";
RL   Online Publication (2010).
FH   Key             Location/Qualifiers
FT   STS             1..79
FT                   /standard_name="PCR 79 bp amplicon"
FT                   /note="taxon-specific RT-PCR for maize"
FT                   /target="high-mobility-group (hmg) gene"
FT   primer_bind     1..23
FT                   /standard_name="Primer forward: ZM1-F"
FT                   /note="TTGGACTAGAAATCTCGTGCTGA"
FT                   /target="hmg"
FT   primer_bind     complement(34..56)
FT                   /standard_name="RT-PCR probe: Probe ZM1"
FT   primer_bind     complement(58..79)
FT                   /standard_name="Primer reverse: ZM1-R"
FT                   /note="GCTACATAGGGAGCCTTGTCCT"
FT                   /target="hmg"
SQ   Sequence 79 BP; 16 A; 13 C; 22 G; 28 T; 0 other;
     ttggactaga aatctcgtgc tgannnnnnn nnntacgcgt gcgtttgtgt ggattgnagg        60
     acaaggctcc ctatgtagc                                                     79