ID QL-CON-00-006; SV 0; linear; genomic DNA; STS; SYN; 172 BP. XX AC MON-04032-6; XX DT 23-JUN-2009 DT 05-OCT-2016 XX DE Qualitative PCR method for detection of the junction between the CaMV35S promoter and the chloroplast transit peptide sequence (EU-Project SMT4-CT96-2072:1998). XX KW construct_specific. XX OS Glycine max (soybean) - event GTS-40-3-2 (MON-04032-6) XX RN [1] RP 1-172 RT "Developments of Methods to Identify Foods Produced by Means of Genetic Engineering Techniques (DMIF-GEN) - Final Report" RL EU-Project SMT4-CT96-2072:1-99 (1998). XX RN [2] RP 1-172 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QL-CON-00-006.pdf XX DR GMOMETHODS; QL-TAX-GM-008; XX FH Key Location/Qualifiers FH FT STS 1..171 FT /standard_name="PCR 171 bp amplicon" FT /note="Construct-specific PCR" FT /target="Junction region between the Cauliflower Mosaic Virus 35S promoter (CaMV P-35S) and the chloroplast-transit-peptide (CTP) sequence from Petunia hybrida epsps gene" FT primer_bind 1..22 FT /standard_name="Primer forward: p35S-af2" FT /note="TGATGTGATATCTCCACTGACG" FT /target="CaMV P-35S" FT primer_bind complement(150..171) FT /standard_name="Primer reverse: petu-ar1" FT /note="TGTATCCCTTGAGCCATGTTGT" FT /target="CTP4" XX SQ Sequence 171 BP; 55 A; 41 C; 34 G; 41 T; 0 other; tgatgtgata tctccactga cgnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 120 nnnnnnnnnn nnnnnnnnnn nnnnnnnnna caacatggca caagggatac a 171 //