Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:DP-098140-6'
ID   QL-ELE-00-025; SV 1; linear; other DNA; STD; UNA; 108 BP.
XX
AC   ;
XX
DT   25-JAN-2010
DT   23-DEC-2016
XX
DE   Qualitative duplex PCR method for detection of pat gene; bar gene (partim pat) (Debode et al., 2016).
XX
KW   element_specific.
XX
RN   [1]
RP   1-108
RA   Debode F., Huber I., Macarthur R., Rischitor P.E., Mazzara M., Herau V., Sebah D., Dobnik D., Broeders S., Roosens N.H., Busch U., Berben G., Morisset D., Zel J.;
RT   "Inter-laboratory studies for the validation of two singleplex (tE9 and pea lectin) and one duplex (pat/bar) real-time PCR methods for GMO detection";
RL   Food Control 73:452-461 (2016).
RX   DOI=10.1016/j.foodcont.2016.08.037.
XX
RN   [2]
RP   1-108
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2016).
RX   PCR=QL-ELE-00-025.pdf
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..108
FT                   /standard_name="PCR 108 bp amplicon"
FT                   /note="element-specific RT-PCR"
FT                   /target="phosphinothricin N-acetyltransferase (pat) gene from bacterium Streptomyces viridochromogenes"
FT   primer_bind     1..22
FT                   /standard_name="Primer forward: Pat-F"
FT                   /note="CGCGGTTTGTGATATCGTTAAC"
FT                   /target="pat"
FT   primer_bind     53..81
FT                   /standard_name="RT-PCR probe: Pat-P"
FT                   /note="HEX-AGGACAGAGCCACAAACACCACAAGAGTG-BBQ"
FT   primer_bind     complement(84..108)
FT                   /standard_name="Primer reverse: Pat-R"
FT                   /note="TCTTGCAACCTCTCTAGATCATCAA"
FT                   /target="pat"
XX
SQ   Sequence 108 BP; 35 A; 20 C; 27 G; 26 T; 0 other;
     cgcggtttgt gatatcgtta accattacat tgagacgtct acagtgaact ttaggacaga        60
     gccacaaaca ccacaagagt ggattgatga tctagagagg ttgcaaga                    108
//