ID QT-TAX-ZM-002; SV 0; linear; genomic DNA; STS; PLN; 79 BP. XX AC ; XX DT 29-MAY-2009 DT 26-AGO-2021 XX DE Quantitative PCR method for detection of maize high-mobility-group gene XX KW taxon_specific, validated_in_combination. XX OS Zea mays (maize) XX RN [1] RP 1-79 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Quantitative nucleic acid based RT methods"; RL ISO 21570:1-103 (2005). RX ISO=34615 XX RN [2] RP 1-79 RA Mazzara M., Grazioli E., Savini C., Van Den Eede G.; RT "Report on the Verification of the Performance of a MON810 Event-specific Method on Maize Line MON810 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2009). RX DOI=10.2788/59036 XX RN [3] RP 1-79 RA Mazzara M., Foti N., Price S., Paoletti C., Van Den Eede G.; RT "Event-Specific Method for the Quantitation of Maize Line TC1507 Using Real-Time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Maize TC15O7"; RL Online Publication (2005). RX BSHOP=LBNA21828 XX RN [4] RP 1-79 RA Mazzara M., Grazioli E., Larcher S., Savini C., Van Den Eede G.; RT "Event-Specific Method for the Quantitation of Maize Line DAS-59122-7 Using Real-Time PCR - Validation Report and Protocol"; RL Online Publication (2006). RX DOI=10.2788/31820 XX RN [5] RP 1-79 RA Charles Delobel C., Grazioli E., Larcher S., Mazzara M., Van Den Eede G.; RT "Event-specific Method for the Quantification of Maize Line LY038 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2008). RX DOI=10.2788/43570 XX RN [6] RP 1-79 RA Charles Delobel C., Foti N., Grazioli E., Mazzara M., Van Den Eede G.; RT "Event-specific Method for the Quantification of Maize Line MON88017 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2008). RX DOI=10.2788/43272 XX RN [7] RP 1-79 RA Savini C., Bogni A., Grazioli E., Munaro B., Mazzara M., Van Den Eede G.; RT "Event-specific Method for the Quantification of Maize Line MON89034 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2008). RX DOI=10.2788/68713 XX RN [8] RP 1-79 RA Savini C., ; RT "Event-specific Method for the Quantification of Maize 98140 Using Real-time PCR - Validation Report and Protocol"; RL Online Publication (2011). RX EURL_GMFF=DP-098140-6_validated_Method.pdf RX EURL_GMFF=DP-098140-6_val_report.pdf XX RN [9] RP 1-79 RA Savini C.,; RT "Event-specific Method for the Quantification of Maize MON87460 Using Real-time PCR. Validation Report and Protocol"; RL Online Publication (2012). RX EURL_GMFF=2012-01-27_MON87460_validated_Method.pdf RX EURL_GMFF=2012-01-27_MON87460_val_report.pdf XX RN [10] RP 1-79 RA Savini C.,; RT "Event-specific Method for the Quantification of Maize DAS-40278-9 by Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Maize TC15O7"; RL Online Publication (2012). RX EURL_GMFF=2012-08-15_EURL-VL-10-10 VM_JRC76621 RX EURL_GMFF=2012-08-13_EURL-VL-10 10 VR_JRC76621 XX RN [11] RP 1-79 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Maize MON 87427 Using Real-time PCR - Validation Report and Validated Method"; RL Online Publication (2015). RX EURL_GMFF=EURL-VL-03-12-VR.pdf RX EURL_GMFF=EURL-VL-03-12-VM.pdf XX RN [12] RP 1-79 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Maize MON87411 Using Real-time PCR - Validation Report and Validated Method"; RL Online Publication (2016). RX EURL_GMFF=EURL-VL-01-15-VR.pdf RX EURL_GMFF=EURL-VL-01-15-VP.pdf XX RN [13] RP 1-79 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Maize MON 87403 Using Real-time PCR - Validation Report"; RL Online Publication (2018). RX EURL_GMFF=EURL-VL-02-15-VM.pdf RX EURL_GMFF=EURL-VL-02-15-VR.pdf XX RN [14] RP 1-79 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Maize MON 87419 Using Real-time PCR"; RL Online Publication (2019). RX EURL_GMFF=EURL-VL-02_17_VR_MON87419.pdf RX EURL_GMFF=EURL-VL-02_17_VM_MON87419.pdf XX RN [15] RP 1-79 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Maize MON 87429 Using Real-time PCR - Validation Report"; RL Online Publication (2021). RX EURL_GMFF=EURL-VL-07-19-VR.pdf RX EURL_GMFF=EURL-VL-07-19-VP.pdf XX RN [16] RP 1-79 RT "See Cross-references below"; RL Online Publication (2010). XX DR GMOMETHODS; QT-ELE-00-003; DR GMOMETHODS; QT-EVE-ZM-020; DR GMOMETHODS; QT-EVE-ZM-010; DR GMOMETHODS; QT-EVE-ZM-012; DR GMOMETHODS; QT-EVE-ZM-017; DR GMOMETHODS; QT-EVE-ZM-016; DR GMOMETHODS; QT-EVE-ZM-018; DR GMOMETHODS; QT-EVE-ZM-021; DR GMOMETHODS; QT-EVE-ZM-005; DR GMOMETHODS; QT-EVE-ZM-004; DR GMOMETHODS; QT-EVE-ZM-003; DR GMOMETHODS; QT-EVE-ZM-024; DR GMOMETHODS; QT-EVE-ZM-025; DR GMOMETHODS; QT-EVE-ZM-029; DR GMOMETHODS; QT-EVE-ZM-030; XX FH Key Location/Qualifiers FH FT STS 1..79 FT /standard_name="PCR 79 bp amplicon" FT /note="taxon-specific RT-PCR for maize" FT /target="high-mobility-group (hmg) gene" FT primer_bind 1..23 FT /standard_name="Primer forward: ZM1-F" FT /note="TTGGACTAGAAATCTCGTGCTGA" FT /target="hmg" FT primer_bind complement(34..56) FT /standard_name="RT-PCR probe: Probe ZM1" FT /note="FAM-CAATCCACACAAACGCACGCGTA-TAMRA" FT primer_bind complement(58..79) FT /standard_name="Primer reverse: ZM1-R" FT /note="GCTACATAGGGAGCCTTGTCCT" FT /target="hmg" XX SQ Sequence 79 BP; 16 A; 13 C; 22 G; 28 T; 0 other; ttggactaga aatctcgtgc tgannnnnnn nnntacgcgt gcgtttgtgt ggattgnagg 60 acaaggctcc ctatgtagc 79 //