Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


Only one hit for query 'ac:DP-098140-6'
ID   QT-EVE-ZM-021; SV 0; linear; genomic DNA; STS; SYN; 80 BP.
XX
AC   DP-098140-6;
XX
DT   16-APR-2008
DT   26-AGO-2011
XX
DE   Quantitative PCR method for detection of maize event 98140 (Savini et al., 2011)
XX
KW   event_specific.
XX
OS   Zea mays (maize) - event 98140 (DP-098140-6)
XX
RN   [1]
RP   1-80
RA   Savini C., ;
RT   "Event-specific Method for the Quantification of Maize 98140 Using Real-time PCR - Validation Report and Protocol";
RL   Online Publication (2011).
RX   EURL_GMFF=DP-098140-6_validated_Method.pdf
RX   EURL_GMFF=DP-098140-6_val_report.pdf
XX
RN   [2]
RP   1-80
RT   "PCR reactions set up and amplification conditions";
RL   Online Publication (2011).
RX   PCR=QT-EVE-ZM-021.pdf
XX
DR   GMOMETHODS; QT-TAX-ZM-002;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..80
FT                   /standard_name="PCR 80 bp amplicon"
FT                   /note="event-specific RT-PCR"
FT                   /target="5'integration border region (IBR) between the insert of maize event 98140 and the maize host genome";
FT   primer_bind     1..26
FT                   /standard_name="Primer forward: DP098-f6"
FT                   /note="GTGTGTATGTCTCTTTGCTTGGTCTT"
FT                   /target="5'-host genome"
FT   primer_bind     28..60
FT                   /standard_name="RT-PCR probe: DP098-p5"
FT                   /note="FAM-CTCTATCGATCCCCCTCTTTGATAGTTTAAACT-TAMRA"
FT   primer_bind     complement(61..80)
FT                   /standard_name="Primer reverse: DP098-r2"
FT                   /note="GATTGTCGTTTCCCGCCTTC"
FT                   /target="insert"
XX
SQ   Sequence 80 BP; 16 A; 18 C; 17 G; 29 T; 0 other;
     gtgtgtatgt ctctttgctt ggtcttnctc tatcgatccc cctctttgat agtttaaact        60
     gaaggcggga aacgacaatc                                                    80
//