ID QL-ELE-00-018; SV 1; linear; genomic DNA; STD; PRO; 69 BP. XX AC ; XX DT 13-JUL-1983 DT 29-FEB-2016 XX DE Qualitative PCR method for detection of nopaline synthase terminator (T-nos) (Barbau-Piednoir et al., 2014). XX KW element_specific. XX RN [1] RP 1-69 RA Barbau-Piednoir E., Stragier P., Roosens N., Mazzara M., Van den Eede G., RA Van den Bulcke M.; RT "Inter-laboratory Testing of GMO Detection by Combinatory SYBR Green PCR RT Screening(CoSYPS)"; RL Food Analitical Methods 0:0-0 (2014). RX DOI=10.1007/s12161-014-9837-3 XX RN [2] RP 1-69 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2014). RX PCR=QL-ELE-00-018.pdf XX DR GMOMETHODS; QL-TAX-BN-003; DR GMOMETHODS; QL-TAX-GM-001; DR GMOMETHODS; QL-TAX-ZM-002; DR GMOMETHODS; QL-PLN-00-006; XX FH Key Location/Qualifiers FH FT STS 1..69 FT /standard_name="PCR 69 bp amplicon" FT /note="element-specific PCR" FT /target="Nopaline synthase terminator (T-nos) from Agrobacterium tumefaciens" FT primer_bind 1..28 FT /standard_name="Primer forward: tNOS_NN_Fwd" FT /note="GATTAGAGTCCCGCAATTATACATTTAA" FT /target="T-nos" FT primer_bind complement(45..69) FT /standard_name="Primer reverse: tNOS D REV" FT /note="TTATCCTAGKTTGCGCGCTATATTT" FT /target="T-nos" XX SQ Sequence 69 BP; 30 A; 12 C; 12 G; 15 T; 0 other; gattagagtc ccgcaattat acatttaann nnnnnnnnnn nnnnaaatat agcgcgcaaa 60 ctaggataa 69 //