ID QL-ELE-00-025; SV 1; linear; other DNA; STD; UNA; 108 BP. XX AC ; XX DT 25-JAN-2010 DT 23-DEC-2016 XX DE Qualitative duplex PCR method for detection of pat gene; bar gene (partim pat) (Debode et al., 2016). XX KW element_specific. XX RN [1] RP 1-108 RA Debode F., Huber I., Macarthur R., Rischitor P.E., Mazzara M., Herau V., Sebah D., Dobnik D., Broeders S., Roosens N.H., Busch U., Berben G., Morisset D., Zel J.; RT "Inter-laboratory studies for the validation of two singleplex (tE9 and pea lectin) and one duplex (pat/bar) real-time PCR methods for GMO detection"; RL Food Control 73:452-461 (2016). RX DOI=10.1016/j.foodcont.2016.08.037. XX RN [2] RP 1-108 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2016). RX PCR=QL-ELE-00-025.pdf XX FH Key Location/Qualifiers FH FT STS 1..108 FT /standard_name="PCR 108 bp amplicon" FT /note="element-specific RT-PCR" FT /target="phosphinothricin N-acetyltransferase (pat) gene from bacterium Streptomyces viridochromogenes" FT primer_bind 1..22 FT /standard_name="Primer forward: Pat-F" FT /note="CGCGGTTTGTGATATCGTTAAC" FT /target="pat" FT primer_bind 53..81 FT /standard_name="RT-PCR probe: Pat-P" FT /note="HEX-AGGACAGAGCCACAAACACCACAAGAGTG-BBQ" FT primer_bind complement(84..108) FT /standard_name="Primer reverse: Pat-R" FT /note="TCTTGCAACCTCTCTAGATCATCAA" FT /target="pat" XX SQ Sequence 108 BP; 35 A; 20 C; 27 G; 26 T; 0 other; cgcggtttgt gatatcgtta accattacat tgagacgtct acagtgaact ttaggacaga 60 gccacaaaca ccacaagagt ggattgatga tctagagagg ttgcaaga 108 //