ID QL-ELE-00-013; SV 0; linear; genomic DNA; STS; SYN; 84 BP. XX AC ; XX DT 25-MAY-2009 DT 04-OCT-2010 XX DE Qualitative duplex PCR method for detection of Cauliflower Mosaic Virus 35S promoter and nopaline synthase terminator (partim T-nos) DE (Waiblinger et al., 2008). XX KW element_specific. XX RN [1] RP 1-84 RA Waiblinger H.-U., Ernst B., Anderson A., Pietsch K.; RT "Validation and collaborative study of a P35S and T-nos duplex real-time RT PCR screening method to detect genetically modified organisms in food RT products"; RL Eur. Food Res. Technol. 226:1221-1228 (2008). RX DOI=10.1007/s00217-007-0748-z XX RN [2] RP 1-84 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QL-ELE-00-013.pdf XX FH Key Location/Qualifiers FH FT STS 1..84 FT /standard_name="PCR 84 bp amplicon" FT /note="element-specific duplex RT-PCR" FT /target="nopaline synthase terminator (T-nos) from Agrobacterium tumefaciens" FT primer_bind 1..25 FT /standard_name="Primer forward: 180-F" FT /note="CATGTAATGCATGACGTTATTTATG" FT /target="T-nos" FT primer_bind 28..55 FT /standard_name="Probe: TM-180YY" FT /note="YY-ATGGGTTTTTATGATTAGAGTCCCGCAA-BHQ1" FT primer_bind complement(60..84) FT /standard_name="Primer reverse: 180-R" FT /note="TTGTTTTCTATCGCGTATTAAATGT" FT /target="T-nos" XX SQ Sequence 84 BP; 29 A; 11 C; 16 G; 28 T; 0 other; catgtaatgc atgacgttat ttatgnnatg ggtttttatg attagagtcc cgcaannnna 60 catttaatac gcgatagaaa acaa 84 //