ID QL-ELE-00-009; SV 0; linear; genomic DNA; STS; SYN; 118 BP. XX AC ; XX DT 23-JUN-2009 DT 04-OCT-2010 XX DE Qualitative PCR method for detection of nopaline synthase terminator DE (Lipp et al.,2001). XX KW element_specific. XX RN [1] RP 1-118 RA Lipp M., Bluth A., Eyquem F., Kruse L., Schimmel H., Van den Eede G., RA Anklam E.; RT "Validation of a method based on polymerase chain reaction for the RT detection of genetically modified organisms in various processed RT foodstuffs"; RL Eur. Food Res. Technol. 212:497-504 (2001). RX DOI=10.1007/s002170000274 XX RN [2] RP 1-118 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Qualitative nucleic acid based RT methods"; RL ISO 21569:1-69 (2005). RX ISO=34614 XX RN [3] RP 1-118 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QL-ELE-00-009.pdf XX FH Key Location/Qualifiers FH FT STS 1..118 FT /standard_name="PCR 118 bp amplicon" FT /note="element-specific PCR" FT /target="nopaline synthase terminator (T-nos) from Agrobacterium tumefaciens" FT primer_bind 1..24 FT /standard_name="Primer forward: HA-nos118-f" FT /note="GCATGACGTTATTTATGAGATGGG" FT /target="T-nos" FT primer_bind complement(95..118) FT /standard_name="Primer reverse: HA-nos118-r" FT /note="GACACCGCGCGCGATAATTTATCC" FT /target="T-nos" XX SQ Sequence 118 BP; 39 A; 19 C; 26 G; 34 T; 0 other; gcatgacgtt atttatgaga tgggnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnggataa attatcgcgc gcggtgtc 118 //