ID QL-ELE-00-029; SV 0; linear; genomic DNA; STD; SYN; 204 BP. XX AC ; XX DT 25-NOV-2010 DT 15-DEC-2017 XX DE Qualitative LAMP method for detection of CP4 epsps gene (Li et al., 2018). XX KW element_specific. XX RN [1] RP 1-204 RA Li R., Shi J., Liu B., Zhang D., Zhao X., Yang L.; RT "International collaborative ring trial of four gene-specific loop-mediated isothermal amplification assays in GMO analysis"; RL Food Control 84:278-283 (2018). RX DOI=10.1016/j.foodcont.2017.08.012 XX RN [2] RP 1-204 RA Wang C., Li R., Quan S., Shen P., Zhang D., Shi J., Yang L.; RT "GMO detection in food and feed through screening by visual loop-mediated isothermal amplification assays"; RL Anal. and Bioanal. Chem. 407:4829-4834(2015). RX DOI=10.1007/s00216-015-8652-z XX RN [3] RP 1-204 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2017). RX PCR=QL-ELE-00-029.pdf XX FH Key Location/Qualifiers FH FT STS 1..204 FT /standard_name="LAMP 204 bp amplicon" FT /note="element-specific LAMP assay" FT /target="CP4 epsps gene from Agrobacterium tumefaciens type I and II" FT primer_bind 1..19 FT /standard_name="Primer forward: CP4 epsps F3" FT /note="CTTGCGTGGACCAAAGACT" FT /target="CP4 epsps" FT primer_bind join(20..38,complement(60..81)) FT /standard_name="Primer: CP4 epsps FIP" FT /note="AGCAGAACAGCGGACTTCACTTCCAACGCCAATCACCTACA" FT primer_bind 20..38 FT /note="CCAACGCCAATCACCTACA" FT /target="CP4 epsps F2" FT primer_bind complement(39..59) FT /standard_name="Primer: CP4 epsps loop F (complementary to the sequence between F1 and F2)" FT /note="GAGCGGAAGCCATAGGTACCC" FT primer_bind complement(60..81) FT /note="AGCAGAACAGCGGACTTCACTT" FT /target="CP4 epsps F1c (complementary to F1)" FT primer_bind join(93..114,complement(152..171)) FT /standard_name="Primer: CP4 epsps BIP" FT /note="ACACCCCAGGTATCACCACTGTGCACCAAAACCTTGAAGCAT" FT primer_bind 93..114 FT /note="ACACCCCAGGTATCACCACTGT" FT /target="CP4 epsps B1c (complementary to B1)" FT primer_bind 115..151 FT /standard_name="Primer: CP4 epsps loop B (complementary to the sequence between B1 and B2)" FT /note="TATCGAGCCAATCATGACTCGTGACCACACTGAAAAG" FT primer_bind complement(152..171) FT /note="GCACCAAAACCTTGAAGCAT" FT /target="CP4 epsps B2" FT primer_bind complement(186..204) FT /standard_name="Primer reverse: CP4 epsps B3" FT /note="ACACCGTCAGCATCAGTCT" FT /target="CP4 epsps" XX SQ Sequence 204 BP; 48 A; 58 C; 46 G; 52 T; 0 other; cttgcgtgga ccaaagactc caacgccaat cacctacagg gtacctatgg cttccgctca 60 agtgaagtcc gctgttctgc tnnnnnnnnn nnacacccca ggtatcacca ctgttatcga 120 gccaatcatg actcgtgacc acactgaaaa gatgcttcaa ggttttggtg cnnnnnnnnn 180 nnnnnagact gatgctgacg gtgt 204 //