ID QL-ELE-00-011; SV 0; linear; genomic DNA; STS; SYN; 84 BP. XX AC ; XX DT 25-MAY-2009 DT 13-JUN-2017 XX DE Qualitative PCR method for detection of nopaline synthase terminator (T-nos). XX KW element_specific. XX RN [1] RP 1-84 RA Reiting R., Broll H., Waiblinger H.-U., Grohmann L.; RT "Collaborative Study of a T-nos Real-Time PCR Method for Screening of RT Genetically Modified Organisms in Food Products"; RL J. Verbr. Lebensm. 2:116-121 (2007). RX DOI=10.1007/s00003-007-0189-4 XX RN [2] RP 1-84 RT "Foodstuffs--Methods of analysis for the detection of genetically modified organisms and derived products -- Qualitative nucleic acid based methods Amendment 1"; RL ISO/TS 21569:2005/Amd 1:2013 (2013). RX ISO=56164 XX RN [3] RP 1-84 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QL-ELE-00-011.pdf XX FH Key Location/Qualifiers FH FT STS 1..84 FT /standard_name="PCR 84 bp amplicon" FT /note="element-specific RT-PCR" FT /target="Nopaline synthase terminator (T-nos)" FT primer_bind 1..25 FT /standard_name="Primer forward: 180-F" FT /note="CATGTAATGCATGACGTTATTTATG" FT /target="T-nos" FT primer_bind 28..55 FT /standard_name="RT-PCR probe: Tm-180" FT /note="FAM-ATGGGTTTTTATGATTAGAGTCCCGCAA-TAMRA" FT primer_bind complement(60..84) FT /standard_name="Primer reverse: 180-R" FT /note="TTGTTTTCTATCGCGTATTAAATGT" FT /target="T-nos" XX SQ Sequence 84 BP; 29 A; 11 C; 16 G; 28 T; 0 other; catgtaatgc atgacgttat ttatgnnatg ggtttttatg attagagtcc cgcaannnna 60 catttaatac gcgatagaaa acaa 84 //