An official website of the European UnionAn official EU website
European Commission logo

European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)


Perform your search by keyword, select a GMO unique identifier or click a link in the section below.


ID   QT-TAX-GM-003; SV 0; linear; genomic DNA; STD; PLN; 102 BP.
XX
AC   ;
XX
DT   06-AGO-2020
DT   06-AGO-2020
XX
DE   Quantitative PCR method for detection of soybean lectin gene
XX
KW   taxon_specific, validated_in_combination.
XX
OS   Glycine max (soybean)
XX
RN   [1]
RP   1-102
RA   European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission;
RT   "Event-specific Method for the Quantification of Soybean GMB151 Using Real-time PCR - Validation Report";  
RL   Online Publication (2020).
RX   EURL_GMFF=EURL-VL-01-18-VR.pdf
RX   EURL_GMFF=EURL-VL-01-18-VM.pdf
XX
RN   [2]
RP   1-102
RT   "See Cross-references below";
RL   Online Publication (2020).
XX
DR   GMOMETHODS; QT-EVE-GM-018;
XX
FH   Key             Location/Qualifiers
FH
FT   STS             1..102
FT                   /standard_name="PCR 102 bp amplicon"
FT                   /note="taxon-specific RT-PCR for soybean"
FT                   /target="lectin (Le1) gene"
FT   primer_bind     1..20
FT                   /standard_name="Primer forward: KVM164"
FT                   /note="CTTTCTCGCACCAATTGACA"
FT                   /target="Le1"
FT   primer_bind     26..51
FT                   /standard_name="RT-PCR probe: TM021"
FT                   /note="JOE-CCACAAACACATGCAGGTTATCTTGG-BHQ1"
FT   primer_bind     complement(83..102)
FT                   /standard_name="Primer reverse: KVM165"
FT                   /note="TCAAACTCAACAGCGACGAC"
FT                   /target="Le1"
XX
SQ   Sequence 102 BP; 15 A; 17 C; 14 G; 20 T; 36 other;
     ctttctcgca ccaattgaca nnnnnccaca aacacatgca ggttatcttg gnnnnnnnnn        60
     nnnnnnnnnn nnnnnnnnnn nngtcgtcgc tgttgagttt ga                          102
//