ID QT-EVE-OS-001; SV 0; linear; genomic DNA; STS; SYN; 121 BP. XX AC ; XX DT 17-JUN-2013 DT 08-APR-2016 XX DE Quantitative PCR method for detection of rice event Golden Rice 2 (Jacchia et al., 2015) XX KW event_specific. XX OS Oryza sativa (rice) - event Golden Rice 2 (GR2) XX RN [1] RP 1-121 RA Jacchia S., Nardini E., Bassani N., Savini C., Shim J-H., Trijatmiko K., Kreysa J., Mazzara M.; RT " International ring trial for the validation of an event-specific Golden Rice 2 quantitative real-time polymerase chain reaction method"; RL J. Agric. Food Chem. 63:4954-4965 (2015). RX DOI=10.1021/acs.jafc.5b00951 XX RN [2] RP 1-121 RA Jacchia S., Nardini E., Savini C., Petrillo M., Angers-Loustau A., Shim J-H., Trijatmiko K., Kreysa J., Mazzara M.; RT " Development, optimization, and single laboratory validation of an event-specific real-time PCR method for the detection and quantification of Golden Rice 2 using a novel taxon-specific assay"; RL J. Agric. Food Chem. 63:1711-1721 (2015). RX DOI=10.1021/jf505516y XX RN [3] RP 1-121 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2016). RX PCR=QT-EVE-OS-001.pdf XX DR GMOMETHODS; QT-TAX-OS-002; XX FH Key Location/Qualifiers FH FT STS 1..121 FT /standard_name="PCR 121 bp amplicon" FT /note="event-specific RT-PCR" FT /target="3' integration border region (IBR) between the insert of rice event Golden Rice 2 and the rice host genome" FT primer_bind 1..19 FT /standard_name="Primer forward: GR2 For" FT /note="TGGCCGTATCCGCAATGTG" FT /target="insert" FT primer_bind 33..59 FT /standard_name="RT-PCR probe: GR2 Probe" FT /note="FAM-TCGATATGATTCCTTCATCGAGCGAGC-TAMRA" FT primer_bind complement(101..121) FT /standard_name="Primer reverse: RB-REV-BS" FT /note="GCTGCGCCTCTAACCAGGTAT" FT /target="3'-host genome" XX SQ Sequence 121 BP; 24 A; 27 C; 39 G; 31 T; 0 other; tggccgtatc cgcaatgtgn nnnnnnnnnn nntcgatatg attccttcat cgagcgagcn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn atacctggtt agaggcgcag 120 c 121 //