ID QL-ELE-00-007; SV 0; linear; genomic DNA; STS; SYN; 180 BP. XX AC ; XX DT 23-JUN-2009 DT 06-OCT-2010 XX DE Qualitative PCR method for detection of nopaline synthase terminator DE (EU-Project SMT4-CT96-2072:1998). XX KW element_specific. XX RN [1] RP 1-180 RT "Developments of Methods to Identify Foods Produced by Means of Genetic Engineering Techniques (DMIF-GEN) - Final Report" RL EU-Project SMT4-CT96-2072:1-99 (1998). XX RN [2] RP 1-180 RT "Screening procedure for the detection of genetically modified DNA RT sequences in foods by identification of DNA sequences that frequently RT occur in genetically modified organisms. No. L 00.00-31"; RL Online Publication (1998). XX RN [3] RP 1-180 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QL-ELE-00-007.pdf XX FH Key Location/Qualifiers FH FT STS 1..180 FT /standard_name="PCR 180 bp amplicon" FT /note="element-specific PCR" FT /target="nopaline synthase terminator (T-nos) from Agrobacterium tumefaciens" FT primer_bind 1..20 FT /standard_name="Primer forward: NOS-1" FT /note="GAATCCTGTTGCCGGTCTTG" FT /target="T-nos" FT primer_bind complement(161..180) FT /standard_name="Primer reverse: NOS-3" FT /note="TTATCCTAGTTTGCGCGCTA" FT /target="T-nos" XX SQ Sequence 180 BP; 61 A; 25 C; 34 G; 60 T; 0 other; gaatcctgtt gccggtcttg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 120 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn tagcgcgcaa actaggataa 180 //