ID QT-TAX-ZM-008; SV 0; linear; genomic DNA; STS; PLN; 79 BP. XX AC ; XX DT 29-JUL-2023 DT 12-JUN-2024 XX DE Quantitative PCR method for detection of maize high-mobility-group gene XX KW taxon_specific, validated_in_combination. XX OS Zea mays (maize) XX RN [1] RP 1-79 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Maize DP202216 Using RT Real-time PCR - Validation Report"; RL Online Publication (2023). RX EURL_GMFF=EURL-VL-03-19-VR.pdf RX EURL_GMFF=EURL-VL-03-19-VM.pdf XX RN [2] RP 1-79 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Maize DP23211 Using RT Real-time PCR - Validation Report"; RL Online Publication (2023). RX EURL_GMFF=EURL-VL-09-19-VR.pdf RX EURL_GMFF=EURL-VL-09-19-VM.pdf XX RN [3] RP 1-79 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Maize DP910521 Using Real-time PCR - Validation Report"; RL Online Publication (2024). RX EURL_GMFF=EURL-VL-04-21-VR.pdf RX EURL_GMFF=EURL-VL-04-21-VM.pdf XX RN [4] RP 1-79 RA European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; RT "Event-specific Method for the Quantification of Maize event DP51291 Using Real-time PCR - Validation Report"; RL Online Publication (2024). RX EURL_GMFF=EURL-VL-04-22-VR.pdf RX EURL_GMFF=EURL-VL-04-22-VM.pdf XX RN [5] RP 1-79 RT "See Cross-references below"; RL Online Publication (2023). XX DR GMOMETHODS; QT-EVE-ZM-034; DR GMOMETHODS; QT-EVE-ZM-035; DR GMOMETHODS; QT-EVE-ZM-038; DR GMOMETHODS; QT-EVE-ZM-039; XX FH Key Location/Qualifiers FH FT STS 1..79 FT /standard_name="PCR 79 bp amplicon" FT /note="taxon-specific RT-PCR for maize" FT /target="high-mobility-group (hmg) gene" FT primer_bind 1..23 FT /standard_name="Primer forward: ZM1-F" FT /note="TTGGACTAGAAATCTCGTGCTGA" FT /target="hmg" FT primer_bind complement(34..56) FT /standard_name="RT-PCR probe: Probe ZM1" FT /note="FAM-CAATCCACACAAACGCACGCGTA-BHQ1" FT primer_bind complement(58..79) FT /standard_name="Primer reverse: ZM1-R" FT /note="GCTACATAGGGAGCCTTGTCCT" FT /target="hmg" XX SQ Sequence 79 BP; 16 A; 13 C; 22 G; 28 T; 0 other; ttggactaga aatctcgtgc tgannnnnnn nnntacgcgt gcgtttgtgt ggattgnagg 60 acaaggctcc ctatgtagc 79 //