Perform your search by keyword, select a GMO unique identifier or click a link in the section below.

ID   QT-TAX-ZM-003; SV 0; linear; genomic DNA; STS; PLN; 135 BP.
AC   ;
DT   29-MAY-2009
DT   09-MAY-2015
DE   Quantitative PCR method for detection of maize alcoholdeydrogenase 1 gene (Mazzara et al., 2013).
KW   taxon_specific,  validated_in_combination.
OS   Zea mays (maize)
RN   [1]
RP   1-135
RA   Mazzara M., Grazioli E., Savini C., Van Den Eede G.;
RT   "Event-specific Method for the Quantification of Maize Line T25 Using Real-time PCR v. 1.01 - Validation Report and Validated Method";
RL   Online Publication (2013).
RX   DOI=10.2788/18420
RN   [2]
RP   1-135
RT   "See Cross-references below";
RL   Online Publication (2013).
FH   Key             Location/Qualifiers
FT   STS             1..135
FT                   /standard_name="PCR 135 bp amplicon"
FT                   /note="taxon-specific RT-PCR for maize"
FT                   /target="alcohol deydrogenase 1 (adh1) gene"
FT   primer_bind     1..24
FT                   /standard_name="Primer forward: KVM182"
FT                   /note="CGTCGTTTCCCATCTCTTCCTCCT"
FT                   /target="adh1"
FT   primer_bind     44..70
FT                   /standard_name="RT-PCR probe: TM014"
FT   primer_bind     complement(116..135)
FT                   /standard_name="Primer reverse: KVM183"
FT                   /note="CCACTCCGAGACCCTCAGTC"
FT                   /target="adh1"
SQ   Sequence 135 BP; 23 A; 36 C; 32 G; 44 T; 0 other;
     cgtcgtttcc catctcttcc tcctnnnnnn nnnnnnnnnn nnnaatcagg gctcattttc        60
     tcgctcctca nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnngactg       120
     agggtctcgg agtgg                                                        135